Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GND1
Systematic Name YHR183W
Strain S288c
Description 6-phosphogluconate dehydrogenase (decarboxylating), catalyzes an NADPH regenerating reaction in the pentose phosphate pathway; required for growth on D-glucono-delta-lactone and adaptation to oxidative stress
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GND1 YHR183W
GCTATGTCACTAATGATCTCGTCGGACTGATAAAATTATGGCTGTTAGAGCTACCCGACA
GCCTAATACCTTCAAACCACTACGATGACTTAATTAAGGCCGAAAAATCGCTAACATCCC
TATGTGAACAGTTTCCGACGAGCTCCTTAAGGTTTCTACAAGAACTAGCAAACCATTTTC
AATTGATCAATAGCAAATACTCACTTCCGCCGCAAACAATACAAGATTTGTTTAGAGACA
ACAGTGACATAGACATACCATTGGCCCATCACTTCGTAAGAAGAACAGGCTTACAGAACC
CTATCGACATCAAAATCTTGTCACCAACATTATCTACATTTTTCATCAACGAAAGAACTG
TAGAAACTTTGCAAACGTTGATCGCAAACAGGATCACGACGGCAACTACTGCGACACTCA
CTGAACCGCCGACGATAATTATAAAGGATACAACGGCACCTATACACTCTACCCCTAAGC
CACCGCCAAACGACAAGGATGGCCATTTCATACCTCGGCCATTCAAGACTAGTTCTACTC
CGACAACCCCAGAGAGACCTAAACGTAAGAGTGGTTTATTCCTTCCCATCAACGTCAACG
ATGTCCCTTCTACATAACTCCATGCATGCTACATAGTAACTACGTAAATCACCTGCTACC
TCTCTGTTCTTTCGTCCCGCCTCGAGGTTGTGCTGCTTTTGTACCTATTGTGGCTGTCGG
TGTTACATTACGGTGCCTCGGTGTTACGCGGTGCTTCGTCCTGGTGGTCCACGCGGCCTT
GCGCTTTGGCCTTGGTGGGCTTCGAGGCTGTATTATATAAATGGGCCTGATGTTCGTTAA
AAGCTGCAGTATTGTTCCTGAGCTTGTTTCTTTTTCAAAGGTTTCCTTTTTTCTTAGTGG
GGTCCTTTCTTACATAATAAAGTAAATAGCCTGATACATATAAACCTGTATTGTTGCCAT
TACAGAAAAAAGCCACTTTCTATACAAAAACTACAATAAA
Chr coordinates Chr VIII from 470960-472429
w3c xhtml validator w3c css validator