Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GND1
Systematic Name YHR183W
Strain S288c
Description 6-phosphogluconate dehydrogenase (decarboxylating); catalyzes an NADPH regenerating reaction in the pentose phosphate pathway; required for growth on D-glucono-delta-lactone and adaptation to oxidative stress; GND1 has a paralog, GND2, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GND1 YHR183W
GCTATGTCACTAATGATCTCGTCGGACTGATAAAATTATGGCTGTTAGAGCTACCCGACA
GCCTAATACCTTCAAACCACTACGATGACTTAATTAAGGCCGAAAAATCGCTAACATCCC
TATGTGAACAGTTTCCGACGAGCTCCTTAAGGTTTCTACAAGAACTAGCAAACCATTTTC
AATTGATCAATAGCAAATACTCACTTCCGCCGCAAACAATACAAGATTTGTTTAGAGACA
ACAGTGACATAGACATACCATTGGCCCATCACTTCGTAAGAAGAACAGGCTTACAGAACC
CTATCGACATCAAAATCTTGTCACCAACATTATCTACATTTTTCATCAACGAAAGAACTG
TAGAAACTTTGCAAACGTTGATCGCAAACAGGATCACGACGGCAACTACTGCGACACTCA
CTGAACCGCCGACGATAATTATAAAGGATACAACGGCACCTATACACTCTACCCCTAAGC
CACCGCCAAACGACAAGGATGGCCATTTCATACCTCGGCCATTCAAGACTAGTTCTACTC
CGACAACCCCAGAGAGACCTAAACGTAAGAGTGGTTTATTCCTTCCCATCAACGTCAACG
ATGTCCCTTCTACATAACTCCATGCATGCTACATAGTAACTACGTAAATCACCTGCTACC
TCTCTGTTCTTTCGTCCCGCCTCGAGGTTGTGCTGCTTTTGTACCTATTGTGGCTGTCGG
TGTTACATTACGGTGCCTCGGTGTTACGCGGTGCTTCGTCCTGGTGGTCCACGCGGCCTT
GCGCTTTGGCCTTGGTGGGCTTCGAGGCTGTATTATATAAATGGGCCTGATGTTCGTTAA
AAGCTGCAGTATTGTTCCTGAGCTTGTTTCTTTTTCAAAGGTTTCCTTTTTTCTTAGTGG
GGTCCTTTCTTACATAATAAAGTAAATAGCCTGATACATATAAACCTGTATTGTTGCCAT
TACAGAAAAAAGCCACTTTCTATACAAAAACTACAATAAA
Chr coordinates Chr VIII from 470960-472429
w3c xhtml validator w3c css validator