Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YIL001W
Systematic Name YIL001W
Strain S288c
Description Putative protein of unknown function; contains a BTB/POZ domain which generally function in protein interactions; deletion slightly improved competitive fitness in rich media; GFP-tagged protein is localized to the cytoplasm
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YIL001W YIL001W
TCTAGAATAGTAGAATGTTCCATCACTAAACAGTTTTTTCAGGGGGCCGCAAGGATGCTC
ATGAATCAATTTATCATAGTTTTGCTCTGATCTCTCGCAGAGGAGGTAGTCGAAAACATC
ATTTTCTAAGCTGTAAAAGTCAACATCCAATACTTTATAAATGCTCTCCGAAGGCCTAAC
TTGATGATCTATCAGTTTCCATCGAGGAAACCCAACATTCTGAACACCAGATATGACGGC
AACATATATATCACCATTAAGACAAACGAGCCCTAATAATCCATTAAATATGCAACTTTT
GACTTCGAGATAGTTACTATCACTTGAAAGATCTGTGTCAGGGTAGGACTTGATTGTTAC
GCTAGGAGTTTTACTTAATTGACGCTGCTGAGAACTGGCACCTGGTATGCTGCGCAAACG
CTGGAAGGATAAACAGTAGTTGTTGGAAGATATTACAATCGACCGTGATCTTCTACCGAT
GAAGAGTCTCATTGTAGTGAAATGTGCTTCGAATTCATACGATTAACACAACTTTATCAA
TATTTGCTGACTTAATCCTAGAATGAAATAGAAAGGCTATTTGATTTGTGTAGATATTTG
TTCCAACTTTCCGGTTTACAAATGTTTAACAAAGGGATTCGTTTAGCAATTAGGCAATGC
TAAACAAGAAGGAAAACAGGAAACCCTGAAGGAGATAAAACGACGTCAAGAATAGAAGAT
AAAAAAAAAGGGACATTAACAGGTTATATTGAAACTCAATTCCTGCCTAACCTTCTAAAT
TGAGAATTTAGAAACGGTATCGCTTATTCTGAATTCCTAAAACACCCATCCCTTTTAAGT
AAAATAATAATACGTGGACTACGTAGATGTGGACACTCAATTTACTTACTATTCTCTATG
GTCATATTGACAATAAACAAAAATACAAGAAAAAAAAAACTACAGGAAAGATTTGTCATA
AATTGTACACTACCACTTGAAAACGACCTTTGGCATATTT
Chr coordinates Chr IX from 353940-355481
w3c xhtml validator w3c css validator