Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name EMC5
Systematic Name YIL027C
Alias KRE27
Strain S288c
Description Member of a transmembrane complex required for efficient folding of proteins in the ER; null mutant displays induction of the unfolded protein response, and also shows K1 killer toxin resistance
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EMC5 YIL027C
AATATTTGAGCTCAAATTGCCTGCAGACGCTACAACATGGAGATATAGTATGAGTGAACA
ATTTCCATTTTACCTTCACGATAATGCTTCCAAAGTGCTTTTGAAAATATTTTTATATTT
GGAGAGTCTTTTCGCTAAGCAAGTTGACGTCCAATTAGAAAGGGTAGCAGATGAAGACGC
CAACCTAAATGATTTGCCGGAAACCGGGTTTTTCGAGAATATTGAAACTGAATTCCTTTT
ATTCACAGTTAAATTGAAGGGACTAATGAAACTGAATATTTTAGATGAACGATTTGCTTC
CCGTGTGGCACTAAACAAAGAAAAGCTTGGCCCGCTGTTCAAAAAAATCGTAGATGATAC
CATAATGGAAAATCCAGAACCTAATAAAAAGAACATACAGAAAGCAAAATCAAATCAAAC
ACAGAGGGAAAAAGCGCCTTTACAACCCAACAGTGAACGAGAAACCGACCATGCAAATAC
TGAAAATAATGATCCAGATATTCCCATGACAATCGATCTAGAACCTATTGAAGAAAGTTC
GCAAAATAATTCAGAGTTAGCACCAATTGAGGAACACCCAACCGTGGTAGATGCTATAGA
CAACAGCGACGAAATCACACAAGATTAAGGGAAAAGATATACGTCAGACTTATTGCTCTT
TTGTAAAACAATAAGATCTATAATATATATCACATCTTTCTTTTGAACATACATAGCTTC
GTTAGCAGTTTTTGATTAATCATAAATACTTCAAATATCCCTTCGCATTAGACTATACTC
GCTGGATGATATTCGGCTATGTATTTTCCAAGCCCATTCAATCGTCATCAAAGCGCCCTT
TGCTTCTTCGAAAACTCGCGATGTAAACGCAGCGCAGAAAAATCTACTTTTGAATATAAA
ATAAAGTCAACTCAGATAGTTGTTATGCATGTTAATTGTAGCATCTAAAAAGCGATCGTA
ATTAAGCCCTACCGAGATACAAAAAAGCAATTATCAAGAG
Chr coordinates Chr IX from 304104-303679
w3c xhtml validator w3c css validator