Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YIL059C
Strain S288c
Description Dubious open reading frame; unlikely to encode a functional protein, based on available experimental and comparative sequence data; partially overlaps the uncharacterized ORF YIL060W
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YIL059C	6322131 upstream sequence, from -1000 to -1, size 1000
AGCCACTCATCTAAGTTTGGGGAGCTGTTTTTATGAATTAACGAAATTTTATGAATTTAC
GAAATATAGCATGCTATATAAAATAATTTATATGCGCATGTATTTTGGTGTGCACCTTCT
TACTGGAGTGTATACAAGTCTACAAATCAACACATGTGGTTTTTTTAATGTTTTGTCGTC
ACAACGCGACCTTAAATAAAAGAATTCCACGCTAGATTCATGCTACTATCACGAACAATA
CGTACCAATTAAGCTTTCTTGGTGTAATAAAAAAAGAGAAATGTACACACCACCATGATT
CCGTTTACGTCTTGCTTTTCTACTTGTTTCGCTCATGGGTTCTCATCAGCTCTATTGTGT
GTGCCCTCTTTGTAGATAATTAAACACATTGAAAAAAAAGAAAACGAAAAGATGGCACAC
GGCTTGGTCATCGAGTGAAGAAATGAAACTTCAAAAAAATTGCCGGACACTTAAACCTTA
ACGAGTTATACAGAACCGTATCCAGACCTGGAGCTGGGCTATAAGAAGAAGCGACAATAT
GGTATACTAAATTTCTGGACTCGTAGTCACTCAGTCTGTTTGTCAGTAAGTCACGTAGAC
CTGTATCGGCAGTAACTATGGTATTTTTTCCAGATTAATTATTATACGATGTTGTTACTT
CGATAAGGTCACAACAGGTTTTCCATTGTTGAGAAACTGACTTTGATTATTATTTAGTTA
GTAGGCAACTGTCATGTTGCAACCACAACAAGCAACAATCCTTTCACCATGACTATTATA
AGCGGCCGGCAAAATTGCCGGGAAAACTGCCAGGGATATAATGCAACCTTCATTTGAGCA
CTTAAAATAGAAGATAACGTTGGTAAACCCCCCTTGATAGTGGACACATCCTACGTAGAT
CTCTCTACAGCCAAGTCGTATATATAGCAGCAAATTGCAACCAACCACATGGGACATAGG
AATGAGTGGTTTTCTCAGACCCTGAACGTGACCGTCCATC
Chr coordinates Chr IX from 246915-246550
w3c xhtml validator w3c css validator