Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SEC6
Systematic Name YIL068C
Strain S288c
Description Essential 88kDa subunit of the exocyst complex; the exocyst mediates polarized targeting and tethering of post-Golgi secretory vesicles to active sites of exocytosis at the plasma membrane prior to SNARE-mediated fusion; anchors the assembled complex to sites of secretion; interacts with SM-like protein and SNARE regulator Sec1p and may recruit it to sites of secretion; binds to SNARE complexes binteracting with Sec9p
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEC6 YIL068C
TGTTGATAGACTTACGACGACGGATTTGAAAGAGCAGGCTGGAGCACTGACTGCTGTGGG
ATCTATTGCAGCCACTATTCTTACATGCGCAGTTATACAGGCTTATTCACTCTGGAAATC
AGGAAGATTCAAAAAGTATTTTAAAATATACATTTGTTTCATTGGCGGATTAATAGCTTT
GGGATCTTTGCCGGGACTGAACTTGAGGATACATCACTACATCTTAGGTTCTATACTGGT
TCCAGGCTGTGCCACGAGAGGATCATCTGCATATCTGTTCCAAGGAATTTTAGTCGGGTT
AATTCTGTCTGGTGTAGCAAGATGGGATTTTGCAAGCATAGTTGAGACAGATACGGCCTT
GTTAAGAGGAGAAGCAGGTGCTTCTTTGAAGCCACCTATACTGGATTTTAACGACGATCA
AAACCATTCTCTGTCGTGGCATCTAAATGCAACTGATCCAGTAATTGATCAAATAGGAAA
CATCGACGGTTTTTCATTACTTTTGAACGATGTGGAAGTGTACGTAGGCAAGAATGAGAC
TGTGAGTATCGATGTTCTTCGGATGGAGAATCCAGCACTTGCTCAAATGATGGACGATGC
TCTTGATGCCTCTAACGGGACAATAGACTTGTATTTAAGAGTGGCTCGTGCCTCTGTACG
GTCTCCAACGAATAGAGGTGACTATACGAATGCAGGAGTTTTACAGTGGCCGAACGGAAT
GTGGCAAAAGCCTGAACCAGGCGTATCATAATCTAAATACATATTTACATACTATACATA
GAATGGGCCTGGAAGTGATAGATTCATTAATACGATGTTATTAATCTTATGTACAGCTAG
CCTTTTTTTCTTAATCTTGCCGAGCTTTGGGGATCGGAAAATAAGAAAACATACTGTAAA
CTCTAGCAACTAGTGCACCTTAAGAACACCCGTAGGGAAGCAGGAAAAGAAGTAAAATTG
GGCCGAGAGCAGAGATATTATCAAGTATCTAGTTACTAAG
Chr coordinates Chr IX from 235474-233057
w3c xhtml validator w3c css validator