Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SUC2
Systematic Name YIL162W
Strain S288c
Description Invertase, sucrose hydrolyzing enzyme; a secreted, glycosylated form is regulated by glucose repression, and an intracellular, nonglycosylated enzyme is produced constitutively
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SUC2 YIL162W
ATAGTAAAAAAAAAACTAAGTTTTCCCCTGTAGTAAACAGGGAGATACCGTACGGAGGTC
TGAATTCCCTACAGAAGTAGCTGTAAAAATTCAGAATTCGCAACAACCTATAATTGAGTT
AAGTGCCTTTCCAAGCTAAAAAGTTTGAGGTTATAGGGGCTTAGCATCCACACGTCACAA
TCTCGGGTATCGAGTATAGTATGTAGAATTACGGCAGGAGGTTTCCCAATGAACAAAGGA
CAGGGGCACGGTGAGCTGTCGAAGGTATCCATTTTATCATGTTTCGTTTGTACAAGCACG
ACATACTAAGACATTTACCGTATGGGAGTTGTTGTCCTAGCGTAGTTCTCGCTCCCCCAG
CAAAGCTCAAAAAAGTACGTCATTTAGAATAGTTTGTGAGCAAATTACCAGTCGGTATGC
TACGTTAGAAAGGCCCACAGTATTCTTCTACCAAAGGCGTGCCTTTGTTGAACTCGATCC
ATTATGAGGGCTTCCATTATTCCCCGCATTTTTATTACTCTGAACAGGAATAAAAAGAAA
AAACCCAGTTTAGGAAATTATCCGGGGGCGAAGAAATACGCGTAGCGTTAATCGACCCCA
CGTCCAGGGTTTTTCCATGGAGGTTTCTGGAAAAACTGACGAGGAATGTGATTATAAATC
CCTTTATGTGATGTCTAAGACTTTTAAGGTACGCCCGATGTTTGCCTATTACCATCATAG
AGACGTTTCTTTTCGAGGAATGCTTAAACGACTTTGTTTGACAAAAATGTTGCCTAAGGG
CTCTATAGTAAACCATTTGGAAGAAAGATTTGACGACTTTTTTTTTTTGGATTTCGATCC
TATAATCCTTCCTCCTGAAAAGAAACATATAAATAGATATGTATTATTCTTCAAAACATT
CTCTTGTTCTTGTGCTTTTTTTTTACCATATATCTTACTTTTTTTTTTCTCTCAGAGAAA
CAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATG
Chr coordinates Chr IX from 37385-38983
w3c xhtml validator w3c css validator