Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRI1
Systematic Name YIR008C
Strain S288c
Description Subunit of DNA primase, which is required for DNA synthesis and double-strand break repair
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRI1 YIR008C
ATCATTTGTGAATTTTTGCTTTTACTAGAAATATATATCATTTTAAACGAAGCCACATAT
AAACGCTGAACTACACTGTAATTCATCATATAGTAAGCTGTCTTATATACTAAATTATCA
CTTCCAAAATGTAATAAACGTCTTTTGGCAATGGGGTACTCTGTGGTTTGCCCTTTGTAT
TATTTAAGCAATTGAAGTGAGGAATAAGCGGCCGTTCTGCAGTATGTCTTTTCGGGAGAC
TCTTTCTGCTACAGATTTTTGTAGATTCTATATCTACTCCATATTGATACATGCCTTGAT
ATTATTTGTCCGTTGACGACCATCTATAACGCCGGGTTGTTTGGATATAAACATTTTGGT
TTGGTTCTGCGCTCTTGACTTTGATGTGCCCCTATGGCAGCTCTTCTCGGTATATACGTG
CTGCTATGAATAGAGCGTTAAGCCAGTCATAGTGTTTTAGTTTCACTCTTGCTGAACTCA
ACTTTCAAAGGCTTACCAAAGAATCGCTCGCCGTTTAATGAAATCTGGGCCAGACTGGCC
TGGTCGATGGTTCTCATGGTGATAAAGGCTTGGCCCCGCTGTTTCTTGAAATTCATGCTA
ACCTTCAGTACCTCTCCAAACGTAGCAAAGAGCAAAAAAAGGTTTACTCGCAGTCGTTGC
ATATTAATTTTTTCATTAAGCTGGCTCACGTACAGCGTATTTTTAGCTTCCGTTACTGGT
TCAGCCACAGTGTGATGAGTATCGCGATCAATCCTCTGCTTTTTCCTTGCTGGTTCAACC
ATTACTATATCCTACGTGTGAATGATGCGTGAGTTTCGAAACAGTTGCTCGGTCAGTGCC
CTTTGCCACTTTTACCTATTGTTTTCTTTCAGTTGAAAAGTTTCATAACGCCAAAAAGAT
AAAAAATTAATCAAAAATACTTTGAAGCTGAAGAGAAAAGCGTGCCATAATACTAGCAAA
AATTAGTTTTAGCAACTCAAAAAACTGTTTTATAAACATC
Chr coordinates Chr IX from 374306-373077
w3c xhtml validator w3c css validator