Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name INA22
Systematic Name YIR024C
Alias GIF1
Strain S288c
Description Protein of unknown function; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies; interacts with Arh1p, a mitochondrial oxidoreductase; deletion mutant has a respiratory growth defect
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>INA22 YIR024C
ACAAACTGTTGTAGGGAGCGTGACAGTGAAGTGGGTCTCATTAATAAGTCATCCGGCACA
ATTCTCTCTCTCTGAACTTCTATACCTTCCACACCTTCCCCCGGCACTTCTCCCTCCTCA
TTATCATCCTCATCTACAACATGATCGAACTCTGCATCATAATCGTATGATATTTCATCC
TCCTCTGATACTTCCTCATTTTGCGAATTATTAGCACTGTTATTCGCAAGTATGGCCATA
CTGTCATTTGGCATGCTATGCAATCCTGTAACACCCTCACCAGTATCATATTCTTCATTT
TCCTGTAGAATATGAGGCAGTATCACGCGTCCTATAGAGCCATTGTTTCTTGGATCCTCT
TCTCTAGAATCGTGCTGCCTGAAGTCTTCCTCATTGTTCCCTTCCGCGTTTTGAGCTCGT
GCTCGAGACCTTAGCATTTCTAATTCGTACATAGTTTTATTAATGCCTATTGGTTTGAAT
CTATTCCATCCTAGCTTGCGTATTTTGGGTAATCTACTTTTGTATTGTTCTGACAGCATT
AGAAATTCGTCTAATTTGCCGTCTAGTAACTGACTGGCTGACGTAGGATAGTAAGGAAAT
TCATTGAACACATTATACGCTGACAATGATGGAATGTATTTCACAACTCTGGATTTCTTC
CTTCTTATAAATCTGTCAAGCGAATCATCTTCATAATCATCTATGCCATTTACATGCTGG
TTCTTCTTACTTCGGAGATCTCTCATGTTATATCTCTCATGCTTGGCTCCTGCCGAATTT
TGATCCTTTCTTATATCATTGAATAATGATATATCCCTCAACGCTCTTGCCATTGCTTTG
TCTTCTCTTCGCCGCTGTTTATGGTTGTCGGTATTCTGATGTGGCGTAGCACAGTTGAAC
TATTTTACGCATCCTCTAATTTACATCTTATGTGATATAATGAGCAGGGAAAAAGTAACA
ACAAGGAAAGACAAGTCATACGTAAAAGGTGTAAGGAAAA
Chr coordinates Chr IX from 403491-402841
w3c xhtml validator w3c css validator