Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DCG1
Systematic Name YIR030C
Strain S288c
Description Protein of unknown function, expression is sensitive to nitrogen catabolite repression and regulated by Dal80p; contains transmembrane domain
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>DCG1 YIR030C
ATGGAAACAAGAATACTTGTTGTGAATCCTAATAGTTCGAAGTCAATGACGGTGTCCTTG
CGGGAAACCATTGAAAAGACTTTTTCAATGGAATCATGTAAAATCAGTTATTTCACAGGG
CCAGACACGTCGCCACCACAAATTGATGGGCAGGAAACAAGTATTAAAAGTATGGAGGCC
TGTCTTCCCCTCTTAATTGATGACCAGGAGTCGGTATATTACTTTCAGAAATTCAACGGG
ATATTAATTGCCTGTTTTTCAGATCATCCTTTGGTAGCAAAGATAAAGGATAGAGCTGCT
AAAGAAAAAGCAGATGTTTCTATTGTTGGGTTATTAGATAGTAGTATTAATTATTGCAAT
TTGGTTGGAAAGAAGTTCTCTATTATTACTTCAAATAAAGAATGGATTCCAATATTGAAT
AACTCTGTGGAATCGAAATTCTTGACAGGGAATACAGTTAACAAAAATTTATGGAAAGGT
ACGGTATCTACTGATTTACAGGTCCTCGACCTACATAGTCCAGAAAATTTCCAGCAGATA
GCAGAAATTATATATCGCGAAAATATTAAAAAGCTTGATTCAGACATTGTAATATTAGGT
TGTGCAGGATTCTCGGGTTTGCAAAATAAACTGGCGAAAACATTCCAAAGGGATGGCACG
CTGTTTCTGGACACGATTGAGATCGGTTTACAGATTCTAATCACTATGATAAGATTTGTC
AACTCACAAAAATAA
Promoter Sequence
Download FASTA
>DCG1 YIR030C
CACGTTTTGCCAAATAGGGATCTAGTGACTATGACTTCACCTTTTATGGATGCTTATGTG
AAAAGATTGATCAATACATGTCACCGTAGAGGGGTCCATGCGATGGGTGGTATGGCTGCC
CAAATCCCCATAAAAGATGATCCAAAGGCTAATGAAGCTGCAATGAACAAAGTTCGTAAT
GACAAAATTAGAGAAATGAAGAATGGGCATGATGGGTCATGGGTAGCACACCCAGCATTG
GCACCGATTTGTAATGAAGTTTTCAGTAACATGGGTACAGCAAATCAAATATATTTTGTC
CCGGATGTACATGTTACATCATCTGATTTATTGAATACGAAGATTCAAGATGCTCAAGTC
ACTACTGAGGGAATCAGAGTAAACTTGGATATTGGCCTACAATATATGGAGGCTTGGTTA
AGGGGATCTGGTTGTGTCCCAATTAATCATTTGATGGAAGATGCCGCTACTGCGGAAGTA
TCACGTTGTCAATTGTACCAGTGGGTTAAACATGGTGTTGTCTTAAGTGATACCGGTGAC
AAAGTAACTCCAGAATTGACCGCTAAGATATTAAATGAAGAGACTGCAAAATTGGCTTCA
GCAAGTCCGCTGGGTGAAAAGAACAAGTTTGCCTTGGCAGCCAAGTATTTTTTGCCTGAA
GTCACTGGTAAAATCTTTAGCGACTTCTTGACCACTTTATTGTATGATGAAATTATTAAG
CCAAGTGCCAAACCAGTTGACTTAAGTAAATTATAGAATGTATACGTACATAACCTGACG
AATATTCGAAGAATTTTAGGCGCTGTTTTAACGCATAATCCAATCAAATTTGAGCTGATA
AGGCCTGATAAGGTATGACAAATTGAACTCATATTTTTTCTCCATGCCAGATCATATTTA
AGCCTTTGAAGCGAGAATATGTAAGGAAACTGAATTACTAATTCTTACCTCAGGAAAATC
AAAAGAACAAAGAAAAACTAGCTAAGCAAATTATCGAACG
Chr coordinates Chr IX from 412770-412036
w3c xhtml validator w3c css validator