Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DAL7
Systematic Name YIR031C
Alias MLS2, MSL2
Strain S288c
Description Malate synthase, role in allantoin degradation unknown; expression sensitive to nitrogen catabolite repression and induced by allophanate, an intermediate in allantoin degradation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DAL7 YIR031C
AACTGTCATCCAATCGCTCTTGATGCTTATCTTGTAGGGCAAAAAATCTTTGAAGCAAAG
ATATGGTGACCGTGGTGGCGGAGACATTGACGAAAGAGTCCTTCGAGGAGTATGGGACGA
TAATTTCGCCAGATGAAGAGATTTCAAGGATGCAAAACCTTGAAAAAGGTGCAAACCAGG
GAACAGCGATCAAATTGCTTCAAGTAAGCCAGGTAGAGAATAAATCTACCAGTAAAGTTC
CCAATTGGAACCTATTCCGTTGCTTTCCACAGCCGCACCTGAATAGAGTATTCACTCAAG
GCTCCAATCAGGCGATTTCTCATTCTATCAAAGTCCTCGAAAAGCATCCGTGTAGTACGC
AGACGTTTGTGCCTATGGGGAGAACGTCAGCGGAAGTAGCATACTTGGTAGTAGTCGCTA
AAGAAATTGGAAATAAGCCAGACTTGTCTACGTTGAGGGCTTTTACATGTTTGGGTAATC
AGGCCGTTACCTATGGCTTAGGTACCTGGCATGCGCCCATGATAGTACTTGGCAAGGAAG
AACATTTGGATTTTTCAGTCTTAATCTACGAAAGTCTGGACCCTGACAGGCCCGAGAAGG
ACTGTGTGGAAGAACACTACAGCGATGGCGACGTTTGTATTATCATCTAATTCTGCGACT
GTGGGCGAAGTAAATATGTAAATGTTCATGTATTAGTAATTTCATAGGTTTACGATTATC
GACATAAAATCTCCGCTGAAAGTTGCGGTGCGATAGAATACCGCGGATTTTGGAAAATTG
CGTTTGCTTTTCTTATCACATAAATTGAATTTCATAAGTTTTGGCTTATCTTGGATAAGG
TACATCGTGAAAGTATCACAAAGATTGGATAGTTTCGTCAATTGGTGAAGCAATAAGTAT
AAAATGGGGACATTTACGCATGTAGTCTTAATTCTTCACTTTCTGTGCAGTTGATATCAC
TTAGAGTATGTGTCATAGGCACGGTAAAGAGCACTGAACA
Chr coordinates Chr IX from 414679-413015
w3c xhtml validator w3c css validator