Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YIR043C
Systematic Name YIR043C
Alias YIR044C
Strain S288c
Description Possible pseudogene in strain S288C; YIR043C and the adjacent ORF, YIR044C, together may encode a non-functional member of the conserved, often subtelomerically-encoded Cos protein family
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YIR043C YIR043C
ACTAACCACTCAATTTTTATAAACTTATGTCAATATTACAGAAAAATTACCACTAAAATC
ACCTAAACATAAAAATATTTTACCTTTCAACTTTACGAAATAAACACTTTGACTTGAAGT
ATGAGCACTACCATGACGTCATTAATGTAAAAGTTCCTTAATATCGTCGTACCACTATGC
TCTATTTAATATATTGTAATATAACTGCACTCTATAGTCATACAGATATTTTCACTTCGC
CCTATCTTCCCATACTATTGTCATGGAATCTCACACTGACGCATGATTAAACGAACAATT
TATACTATAAGGTCTGTCATTTGCGCTCTATCCTTTTGTTTGCAATATTTATATACAGAA
TCTCAAAACAAGCGGGAGAAGTGGTAATTACCCAGAGGTCATGCATGATCTGAGTACCAC
CATACCTCTAAGTTTTTGCTTTGATCCGTTTTACAGTGACAACAAACATAAGGAGAAGGC
ATTAAAATGGTATCGAAAGGTTATCAATATAGGGAAATAAATTGGTTCTATGAATCTTCA
TGTAAGATACTCGTAGGCCAGACTCTTTCCCGTGTAAATATTTGTGACAGCTACGTCTAT
TTTCTACTATATGTTTACACAGTTTTCTCACAGGCAATCTACGCTTAAATATGTGTTTCA
TTTCAGGCGGCAACTGCTGTGCGAGCAGTGACATTGCCGGTCGCACCTTAAAACGTAAGC
CAAAGTTATGACACGCTCTCAAAGTACCCGCATTAAAGTTTTATAAAAGTATTATTACGA
CTATCGAGTAACTTAGATAGAAAACCGGAAATGAAATGGATGCCCTTTTCGAATAGCTGA
GTTTCTTTGTCTAAAATAGCCCAACATTGTTGCCCTTTTTCTATCATGAGATTGCACGAA
CGCGCGCGCTTCGGCGGCTTTTTTTTCTGCTACATAAAAGCGAAAAGGAAGAAGTTATTA
CTTTGAATAAAAAAACCTCGAACTGCCATCTCACTACCAA
Chr coordinates Chr IX from 438179-437043
w3c xhtml validator w3c css validator