Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PEP8
Systematic Name YJL053W
Alias GRD6, VPS26, VPT4
Strain S288c
Description Vacuolar protein sorting protein that forms part of the multimeric membrane-associated retromer complex along with Vps35p, Vps29p, Vps17p, and Vps5p; essential for endosome-to-Golgi retrograde protein transport
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PEP8 YJL053W
ATAGGTATCTTCTATACAATGCCAAAACCGAAGCATATAATAAGTGAAGACGCCCTGACA
AAGGACCCTATATTATCTGGTGGTGTTATTTGTTTAGGTAGAGGCGCCTATAAGGAGTAC
ATTGCCGGTATTCACGAAGGCTTGCTTGGACCCATCGAGAAGACCGAAAAAACAGGATCC
ACTGAGCCTAAGATGACTGGGGTTGTAGAAGCAAATCAAATAGAATCAAAGGTAAGTGAA
TCCGGTGCTACGGAACTGGTGGATGCCGAGAAAGAGACTGCTTTGGAAGAGGCCAAAGTA
CAAGATGATCTAAAGGTTGATGAAGAAAACAGCTCAGAGGATTCGCAAAAATTTTTGAAG
CCATTTATTTCTTCAGACCAATACCCTGACCTGCAAATCGCTTCGGAATTACAAACTCCA
AATGGCGAATTCATAAGAAACCCCAATACAAATATCCCGCTTCTGATTAATCAGCCGTTA
TTGGTCATTCCAATACCTAACTTGATAGGTTTTACTACCATTCCAAGGAGAATACATCGT
TTTTACCAGAAGCGTTTCTACGTAGAGGACGTGTGTTCAAGTGTAGTTAACTGTGTTCGA
CAAACCCGTATAAGACCGTTTGATATTGCAAAGGATATTGATTTGGCGAAGGACGAAGAA
AAAGATTGGCCACAGAACTGGGTCAAACAGGGTAAAGAAAAGAACAGCGAATGGACCCAA
GAATTAGTATGTGATCCTAGAATCACGAAGCATATGTTTGTTTACGAAAAACCACCCAAG
GAAGAGCCAGAATCAGATATTTAATTGGATATATATTATGTTTTATCATCATGCACGATC
GACGTTATGTCTGACATATACCAAACCCTTTTCGAAGATTTCCCTTTACTCATGTTGAAA
TAGTTTTTATATATGCACACATATACATATATATAAAATCTGTAAATATAATAAAATGTG
TACATTGTAAAAGAATCCAAGCACAACTATTATTAGCATT
Chr coordinates Chr X from 335898-337037
w3c xhtml validator w3c css validator