Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FAR1
Systematic Name YJL157C
Strain S288c
Description Cyclin-dependent kinase inhibitor that mediates cell cycle arrest in response to pheromone; also forms a complex with Cdc24p, Ste4p, and Ste18p that may specify the direction of polarized growth during mating; potential Cdc28p substrate
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FAR1 YJL157C
GATTATCAGATTTTGCTATTATCAAAGTTAATTCATCATTCAAATGTCAGAATACCCTAG
GTAATGGCTTAAAATCATTCCCAGATCCAACATTAAGATTTCAAAATTTACATGTGAAAC
GAAAAATTTTTAAAATGAAGCCTGGGATGAAAGTATTTAAAATAGGGGCTTCTACGGGAT
ACACTTCAGGCGAGTTAAATTCTACAAAATTAGTTTATTGGGCCGACGGAAAGTTACAAA
GTAGCGAGTTTGTCGTTGCATCTCCAACTCCTTTATTTGCTAGTGCGGGGGATTCAGGCG
CATGGATCTTGACCAAGTTAGAAGATCGTCTAGGTTTGGGGCTTGTTGGTATGTTGCATT
CATACGATGGTGAACAGAGGCAGTTTGGTTTGTTCACACCTATAGGTGATATCCTGGAGA
GACTACATGCTGTAACTAAAATTCAATGGGACATTGATCCACAACTAGATGGATGATTTG
CCTTTTTGAAGTTATTTAACCCATTACAGGATGAAAAAAAAAAGACATTGCACTTGCATC
ACTGTAGGAGCGACTATAAAACTCACCTTCATTGTTGCTTTATTTTTCCAAGTAAGGAAA
AATATCTGTTTACTTTCATTTACCTCTTTGGTTTTGTTAGGCGGGCAAGAGAGACCCGGT
CGTTTCAGAATGCAACTTTCTTTTGTTTGCATATCTTTTTTTTTCAGCGATGCAATTTTC
AACATGCAGCCATTTCACCGAAAATACCTAAAAAGGAAATAGGCAATAAAATGACATCGT
AAAGGTTTCAAATGCGAAGGTACCTTGGTTCACAGTATATAATATATTCAAATTATTAAA
AGAAAATAAAACTATCCTTTTTGTTCACTCTGTCTTGAGAGTGTATATTATCTTATCTAT
TCAAAAAATTTCTATTTACTTTTATATTTCTTGACCATCCTTTACACAAAGTCTATAGAT
CCACTGGAAAGCTTCGTGGGCGTAAGAAGGCAATCTATTA
Chr coordinates Chr X from 126328-123836
w3c xhtml validator w3c css validator