Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PIR5
Systematic Name YJL160C
Strain S288c
Description Putative protein of unknown function; member of the PIR (proteins with internal repeats) family of cell wall proteins; non-essential gene that is required for sporulation; mRNA is weakly cell cycle regulated, peaking in mitosis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PIR5 YJL160C
TCTAAGTTCACCTCCATATGGATTAGCGGCCAGGATAATGGAAAAAATTTACCATACTTT
TTTTTGCAGAATAGATCAACAGTTTGGTGCATTTGTTCCTTCTTGTTTTTTTTTTGCTTG
TTTTTACAATTTTTACTGTTTTACTATGAACTGATGGCTGGTATAGTGACAGAGTTTCTA
CTTTTTTGCTACTTAGTAGACTACTATACTAACTAGGACATATGTTGTTCGTAACGGTAA
ATGCACTTAAAGTATTTTACTGTTTTTAATTGGATTTGCTTGTTGTAGTAATTTTTGGAC
TGATTTCGGTCAATCGCTATTTTAATTTTTACTGTTCCTTGCATCTTTTACTAATCCGAA
ATTAGCTCAGCTCAAATTTGTAGTTTACTAAAGTACGCTTTTCCTAAAAGACGAAAACAC
AAATATAGTGAAGACATTATCCGACTTTTTTGCCAAAAAGGGACAAAGCACGAAATTAAG
TAAAACTGTGGTAAAAACTACAGAGGAACGTCGCATTGGCTAGCAAGGATCTATTGTTAC
TCTATCAAAACCCCTTTGCCAAGCTCACATATCCTATTTGCCGTTCCTGAAGGCATCCAA
CTAGGCTTGATATCATCTTACTTATATAGTGGGCTTCTGCTCCTTAACCTGATCAATTTC
ACCTCTAATTTTGTAGGATTCCTGAGAAAATACAGAAATTCTAACGTTCCTCTGATATAT
TACGAGTGAATCATTGGGTATATATAAGAGAAGTGGAGTAACAAAAGCTGTAGAAAGTAA
GTTACACAGAGTCACAAAAGAATATCGACTTTTTGTGCAAGAAAATTCGACTGTTTTGAC
TCACAAAATTATTCTTTTTGCGAAAGAGTGGGGAAACGAAAACAGTTAAAAGAGTAAAAT
AACTTGTATACATATACTTATCTTCTTGTTTCGAAATTTCTGTTTAGTCTCGATTTTTTA
ATTCTATACAACTTACTGAAGAAGTGAACACCGCCCCAAT
Chr coordinates Chr X from 118825-117962
w3c xhtml validator w3c css validator