Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MRX12
Systematic Name YJR003C
Strain S288c
Description Protein that associates with mitochondrial ribosome; detected in highly purified mitochondria in high-throughput studies; predicted to be involved in ribosome biogenesis
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MRX12 YJR003C
ACAACTGGATGGACAGGCGCTATGAATACTTACATCTCGCAATTTACATCCTCTTCTTTC
GCAACAATCAACAGCACACCAATAATCTCTTCATCAGCAGTATTTGAAACCTCAGATGCT
TCAATTGTCAATGTGCACACTGAAAATATCACGAATACTGCTGCTGTTCCATCTGAAGAG
CCCACTTTTGTAAATGCCACGAGAAACTCCTTAAATTCCTTCTGCAGCAGCAAACAGCCA
TCCAGTCCCTCATCTTATACGTCTTCCCCACTCGTATCGTCCCTCTCCGTAAGCAAAACA
TTACTAAGCACCAGTTTTACGCCTTCTGTGCCAACATCTAATACATATATCAAAACGAAA
AATACGGGTTACTTTGAGCACACGGCTTTGACAACATCTTCAGTTGGCCTTAATTCTTTT
AGTGAAACAGCAGTCTCATCTCAGGGAACGAAAATTGACACCTTTTTAGTGTCATCCTTG
ATCGCATATCCTTCTTCTGCATCAGGAAGCCAATTGTCCGGTATCCAACAGAATTTCACA
TCAACTTCTCTCATGATTTCAACCTATGAAGGTAAAGCGTCTATATTTTTCTCAGCTGAG
CTCGGTTCGATCATTTTTCTGCTTTTGTCGTACCTGCTATTCTAAAACGGGTACTGTACA
GTTAGTACATTGAGTCGAAATATACGAAATTATTGTTCATAATTTTCATCCTGGCTCTTT
TTTTCTTCAACCATAGTTAAATGGACAGTTCATATCTTAACTCTAATAATACTTTTCTAG
TTCTTATCCTTTTCCGTCTCACCGCAGATTTTATCATAGTATTAAATTTATATTTTGTTC
GTAAAAAGAAAAATTTGTGAGCGTTACCGCTCGTTTCATTACCCGAAGGCTGTTTCAGTA
GACCACTGATTAAGTAAGTAGATGAAAAAATTTCATCACCATGAAAGAGTTCGATGAGAG
CTACTTTTTCAAATGCTTAACAGCTAACCGCCATTCAATA
Chr coordinates Chr X from 442553-440994
w3c xhtml validator w3c css validator