Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GPX1
Systematic Name YKL026C
Strain S288c
Description Phospholipid hydroperoxide glutathione peroxidase induced by glucose starvation that protects cells from phospholipid hydroperoxides and nonphospholipid peroxides during oxidative stress
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GPX1 YKL026C
GTACCATAGAGGGACAACAACAGCTAGACTACAAATATTTAGGAGAGCTATTATTTAACC
TATCCATTAATATTGAAAACTCTAATAACAACACTGCCCCTAAAGAATATCGATTGGAGG
AAATAACCCCTCAATCAATTGATGACATGAGACAGATCGATGATAAGTTCAAGGATGTAC
TCAAGTATCTGATATCAGACAACGGCGATTCCAAAAAGAGCATTCATGATCTTACTAGTC
ACTTTTATGATAAGATGTTCATGGTCCTGGAATCGTCACAAACCTATACAGAATACATGG
AGTCTGTCTTATCAAGAGAACTAGAAAATGGCAGATTATTTAGGCTGGTCAACAAGCTAA
ATTGCATTTTTGGTAGAATCGAATCAAGAATAGACATAAATTGGTCCGAATCTGGGACTA
AATTCCCCATTATACTATTTTATGACTACGTATTCCATCAAGTGGATTCGAATGGGAAAC
CAATAATGGATTTAACTCATGTCCTAAGATGTTTGAACAAATTAGACGCTGGTATTCAAG
AAAAGTTAATGTTGGTAACGCCCGATGAGTTAAACTGTATTATTATATCCTATAAGGAGT
TGAAGGACTTGATAGAATCCACCTTTCGATCCATCACCCAATAAAACAACACCAAATAAT
GTAGATACACACATATATATTAATTATACATTAGTATCCCCTTGACATACCCCACTACCG
TCTTCATGTGGAAAATTTTCCGTATTTGCTTTCCCCTTCTGTTCCCTAATTCTATAGGGT
AAGCGATTCATCCCTTGTTCGCCACATCTAAGAGAACTTAAAGCCGGGGCTCACCTCTAC
TACAGAGATTGCTTATGGTGAACAATATTAAGTGATTATATAACACAGTAATGTACAAAT
ATATTTTAGTCATGTAGGTGATATTGTGCACGGCGAGGTTCTCTGATTGTGAACCCGTAT
AAGGAATATAAGCGGAGAAACACAATATTTATAAGTAACG
Chr coordinates Chr XI from 389883-389380
w3c xhtml validator w3c css validator