Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CSE4
Systematic Name YKL049C
Alias CSL2
Strain S288c
Description Centromere protein that resembles histone H3, required for proper kinetochore function; homolog of human CENP-A; levels are regulated by E3 ubiquitin ligase Psh1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CSE4 YKL049C
TATTGGTATCTGCAACTAGTAAAGTAACACCTTCGATACATATCGACGAGGAACCGGATA
AAGAATGTTTTTCGACTACGGTCCTTAGATCTTCGCCAGACTCGAGCGATTATTGTTCAT
CGTTAGGGGAGGAAGCCATTCAGGTTACGGATTTCTTAGATACTTTTTGTAGGTCAAATG
AAAGCTTACCTAATTTGACTGTGAATAATGATAAGCAGAATTCGGACATGAAAACTGACA
GAAGCGAGTCATCCTCTCATTCGTCATTGAAAATCCCAACACCTATCAAAGCCATGATAA
GACTAAAGAGTTCCCCTAAAGAGAACGGGAACAGAACCCATATTAATTGCTCACAGGACA
AACCGAGTTCCCCACTAATGGATAGGACTGTTGGAAAGCGCACGGTTAACAATTCAGGGG
CTAGAAAGCTTGCTCATTCAAGTAATATTCTCAACTTTAAAGCATACATAAATTCGGAAG
ATAGTGACATTCGAGAAACAGTAGAAGATGTAAAAACGTATCTGAACTTTGCAGATAATG
GTCAAATATAGATGAAACTACAGGATGATATCTGTCGGATTGGGTTAGCTGATAATCGTA
TAGCCGATGTGAAATATGATTATTAATTGATTTACTTGGTTATGGTAAATACATAAATAT
ATATATAGAAACGGCAAATTACCCACATTTGCATTTGTATTAATAACACTAAAGATAATA
TTCATAATATACCATCATTGATAATTGAAATCGACATCAACATTTATCAATTGAGAGTTT
AGTGGTCTTCTATTGCGAGAATATCGAACGATATGATTTATCTTGATCCCACTGTGTCGC
GAAATCGCGGAAGTAAATTGAAAACAAAAGAAAAACAAAACTTCATCGATAAATATTGAG
AAAACATCTCTTAAAAACAGTAGTAGATAATCTTGAGAATTTACTTTATAAAAAACAGAA
GAAGGACTGAATATAGAAAGAATACTAATATAACATAATC
Chr coordinates Chr XI from 346764-346075
w3c xhtml validator w3c css validator