Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RRN3
Systematic Name YKL125W
Strain S288c
Description Protein required for transcription of rDNA by RNA polymerase I; transcription factor independent of DNA template; involved in recruitment of RNA polymerase I to rDNA
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RRN3 YKL125W
CAGAACTATTGCTAGGTTTAGGCTATACAAAGGCAGTAGATTGGTGGACATTGGGAGTCT
TGTTATACGAGATGCTCACAGGTCTTCCTCCTTATTATGATGAAGATGTTCCAAAAATGT
ATAAGAAGATTCTACAGGAGCCACTAGTTTTCCCAGATGGATTTGATAGAGATGCAAAGG
ATCTATTGATTGGATTATTGAGCCGTGATCCGACAAGAAGATTGGGCTACAATGGTGCCG
ACGAAATTCGGAACCATCCTTTTTTCAGCCAATTATCATGGAAGCGCCTGTTGATGAAGG
GTTATATTCCACCATATAAACCAGCTGTTAGTAATTCCATGGATACTAGTAATTTCGATG
AGGAATTCACTAGGGAGAAGCCAATTGATAGTGTGGTAGATGAATACTTGAGTGAAAGTG
TTCAAAAGCAATTTGGTGGCTGGACATACGTTGGAAATGAACAGCTAGGTAGCTCAATGG
TGCAAGGTAGAAGCATTAGATAGACTTAGTGAATACATTATCAACTAGTTTACTCATGAC
ATACTTTATATAAAAAGAAAGGTTTTCTTTTCCGTTACTTACTGTGTTCAAGATGAAGCA
ACTGTACCAATGGCGCAATTTAAGTTCTAGGATTTATATTTCGAACGTGGGCAATACTTC
ACACATGTGTGGCTTGTGTCTCATGGTCATAGCGTATTGCCTCAGCTTATTCTGATTAGA
TAAAGGATTTCCTCTCTTACCCTTCCGAGATCCGTGTCGATGGGGCGGCAGAAAATAAAA
AAAAAAAAAGGTGTTGAAAATTTTCTCCTTGTATAAAAGATATTTTGATGAGCATCTCTC
GTTTGCAGTAGCTTCTCCTTTTAAAAATATAAAGGTTGTTTTAATCAGCGTTCGACTTTA
AATTAACCCAAGACCCCATTGTTAAAATTCTTACCTTAACCACGAACGGATACATTGTCT
GGTAAAGAAATAACTTTTGTGCAAGACAACAGCTGACAAG
Chr coordinates Chr XI from 208247-210130
w3c xhtml validator w3c css validator