Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CBT1
Systematic Name YKL208W
Alias SOC1
Strain S288c
Description Protein involved in 5' RNA end processing; substrates include mitochondrial COB, 15S_rRNA, and RPM1 transcripts; may also have a role in 3' end processing of the COB pre-mRNA; displays genetic interaction with cell cycle-regulated kinase Dbf2p
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CBT1 YKL208W
GGATAGAAGTAATTGCCGGCACTAGGCCTGTTGCCACGGTACCTATTATCATTATCATTA
ACAGCCTGTAGTCATTCCGTATGTTCACGTACCTGAAAATGTGATAGTGTTTTGTAGTCT
TAAAACTTAAAAAGTTCATGACGTAGCTTGTTCTTTGTTTCCTAGTGGAATTTTCAGCGG
CACTTGAAAGCTCTCTGTGTGAACGTAACAACGGGAGATAGTTCAGCCATATCCAGGTTT
ATAAGCTCTGGTATTTAAATGATGAACGGCAATAATGCAACAGTTTTCATATCTGAAACA
ATTGTATATGTGCGAAGCAGCGTGTAAATTTCCCTATTAGGTAATTACATGGCAAAAAAA
ATAAGAAACTATTTTCTTAAAGTACCTTTACCCTTTGTGGAAAACAATAAATTGTATAGT
GGCAGAATAGAGAAAAGAAAAAGGAAAGGAACATATTTGTCAGTGCAAGGACCATCATTG
TTTGAAAAAAGAGAGGATATTACTAGTAGGTAATAACAGCTATGTCGCGTTATATATATT
ATATATAAAAATTAAAAAATAGAAAATAAAATTTCAAATGCCCTCTGTGGGAATTGAACC
CACGATCCCCGCATTACGAGTGCGATGCCTTACCACTTGGCCAAAAGGGCTGAGTAATTT
TTATACCTGCTAAATTTGTGGCTCCGCTATACTTTACAGATTTATCTATTTTGAAGATGA
TACATTTAGCAAAAATGACCTTAAAAATGAAGCAGGTGCCATTTGCCTATAGCTTGGAAA
AGTAGTAATGGTTATTCAAAAAGTTAGCAGCGAGATCTTTTTTCTATCGCGCGTTAAAAC
GTTTGAACAGATATATATTATTCAGCCACAACTATCTATATATAATATTTCTTCGATTTT
TCGTTTTCTCAAGTTTCGTCTTATTGATTGATCAGAAGTTTACTGCGCTTTTGGGTAAAG
AAGCATTAAACAAAGGAGAGAGAAATATTGCAAGGAAAAA
Chr coordinates Chr XI from 47157-47972
w3c xhtml validator w3c css validator