Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YKR045C
Systematic Name YKR045C
Strain S288c
Description Putative protein of unknown function; epitope-tagged protein localizes to the cytoplasm
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YKR045C YKR045C
GCGGAATCTCTGCCACCTGTGGAGAGATTGATTTCCTTCAACCTCGTTGTTTTGGGATCT
GTGAACCAGTGGGTTTCCGAATCGTCCAGCTCTCCTCGTCTGGTGAAGCAAGTTGTTGCT
GCTGGGAAGGAAGGGGCCTTCAAGTTGGACGAGTTAGTTAACCTCTTGGTGTTCAAGGAG
GGTGTCGACGGCTTGCTGTACAATTGGAAATCACATTCCAACACGCCAGGGATCTGGCTG
GTGTGGTTCTTCGTCGACTACGTCGCCAACATTTCTAATACTCTGTTGAGGGAGTTCCTG
ATCAAGCCATTGCACTTGCAAGGTTCTACCGCATCGAAGGAGATCGGCTCTTCCGGTGAG
GAGAACAAGGTCACTGATGCTTCTTCTTTGCCCCACGTGGCAGAGTTGTCTTCAACGACC
AGAGGTATGTCGCAGGAGATCCAGTCCAAGGTCAAGTCGAACTATATCGACCCAACCAAG
GACCTGGCTAAAGAAAAGTACGACGCCATAGTGAAGCCCACAACTGACAAGTTGCAGTCT
GTGTACATCGACCCAACAAAGACTAAGCTTAACGAAACCTACCAACGCTTCACCACTGTC
TATGAAAACAATCTAAGTAAATCTGAAAGCGTCCCTAAAGCCATTGTATCCACCGGGTTG
GACTTGGGCAATGCCACCATTGAGAAGCTAAAGGCCTCAAGAGAAGACCAAACCAATTCT
AAGCCCGCGGCTGTGTCGACCAATTAGTAATTTGGTTTTGCGCTAATCGTGCGCCTGATT
TTTTTTCCTGCCACTCTTATATAGTTATTTGTTATTATTCTATTATTTCATCTATTGTTT
GCTAGCTATTATGTACGTTGCTGTTTGAGCACTATATACAATTGAATACCAAAGAAAAAA
TTATAAAAACGAAAAAAAAAAAAAAAAAAAAAAATTTGGTTATAGCTCGATCAAGAGACA
ATAAAAGTGAATATACATGGTGCCAAGGGAAAGTCCTAGC
Chr coordinates Chr XI from 523969-523418
w3c xhtml validator w3c css validator