Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name COX19
Systematic Name YLL018C-A
Strain S288c
Description Protein required for cytochrome c oxidase assembly, located in the cytosol and mitochondrial intermembrane space; putative copper metallochaperone that delivers copper to cytochrome c oxidase; contains twin cysteine-x9-cysteine motifs
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>COX19 YLL018C-A
TCTATTTGGATTTGAAAAATATCAGAAGAGCTTCATTGTTCCCAAGAGATCCAAAGAGAT
TAAGACCATGAAGGAGTCTCCTCCAACGTTTTTATGTAGCGAGTGAAGGTAAAAAAATTT
TCAACATTTCTAATTTTTTCCTGTCACCCACTTTTATTTTAACTGAATTATTATATTTAG
CTTTACACATATAAGTCTCAACGTCTGACATATGTCACACTTTCTTTACCGCCAGACCAC
TTCTAATATTCCGAAAGCAAGGGCTATGAGCAGTCCGACAATTCGGAAACCATAGCTCGC
CATAATTTACACGCTCTATGCACATATTAAAATACATTTAAACAGTACTTACAGCGCATC
TGGGATGGTTCGGTTATGTACCAGGACAATATTAAGTTGACGCGTCAGTTGAGTAGTAAT
CGTCCTAGTATTTTCGCCTACCATGCCGCTTTTTGCGTTTTTGACCGCCTCTGGTCCCTT
ATACAATCCACAGGCAAAAAAAAATTACATAACAAGATTACTCTTCAAGAAACCTGGAAA
ATATTTTTTTGGGCAGTTTTTTAAGACGATAATAAGTTCTATGCCTCATTTACGCACCAG
CGGTTCTATTACCAAGCTGACTCTTATCGGCGATGAGTATGATCTAAGGCTCGGGCCGCC
CATTTTGCTGCTCCCGGTCAAGTAGCACGCTCCCTCTTTTCTTATCGCAGGCTTTGCCCA
CTACCCGATCTCTAAAGCGCCCATTTAACCTTTTTTAAAACAACAGCTTAAAAGCTTTTT
GGATAAAAAGCTTTTATTACTACATCTCTGCATCTTCTCTCCGGGGTCTAAGAAAAGGGC
TCAAATTCGCGGAGTTGAGAAACGAGAAAATCCAAATAAAGCGAACAAGAGGGAAAAAAA
TTTTTTCTTCCGTTCTTTCCTTCTTCTATACTTCAAGAAAACAAGCAAACGCACCCACTA
CACACAAAGTATCTTTTACGAAACATAACACAAGAATCCA
Chr coordinates Chr XII from 108972-108676
w3c xhtml validator w3c css validator