Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ISA1
Systematic Name YLL027W
Strain S288c
Description Protein required for maturation of mitochondrial [4Fe-4S] proteins; functions in a complex with Isa2p and possibly Iba57p; isa1 deletion causes loss of mitochondrial DNA and respiratory deficiency; depletion reduces growth on nonfermentable carbon sources; functional ortholog of bacterial A-type ISC proteins; human ISCA1 can complement isa1 null mutant
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ISA1 YLL027W
TGCTTCCCATTGTTTGCAGGATATATGTTCCGTGGCATGGGTATCGGTTGGGCTGGTTTG
TTATTAGGTCTATTTGCCGCTGCGATGATTCCCGTGCCTTTACTATTCTTAAAATATGGT
GAATCTATCAGAAAGAAATCCAAGTATGCTTACGCCGCTTAAGAAAAAGAAAAGCAGAAA
TCATGCTCTTTCTATATTTGCATTTTTTTATTTCATTGTTATTACTCACCCTGCCCCACG
CTCAAAGGGCTCGATAACGACATAGCATTATAGACACTGTGCAGCGTAAAGCTGACATAT
AAAGAAATTACAAAAAAAAATTAAAAAAAAAAAAAAAAACAATCAAAAAAGACACACAAC
TACAGAACAAAGGAAATCTTTTTCTATGCACAAGCACAAGAGTACTTAGAGAGTAGTGAT
ATCCCCTTTTTTTTCTACTATTTTTTTTTTTCCCATTTTTTTCCTCCAAGACTCCTCTTA
TGTGGTTGTTATGTATAGCCCATAGTTACTAAATAAAACACTAATTAATGATTAATAATC
CCTCTCTAATAAGAAATAGATAAAAGCTATTGTTCTTCTCATCGCCGGTTCTCGGCGTTG
TCCGTACCCTTGGCCGAAACTCGGGCGGGGGCTTATTAGTCATACCCTCAGATTTCATTG
GTCAGATAACAGTCACCCGGTAAATGCCCGTTTAATGACTTCTTTATTTTGGATTAAAAT
TGACAGGGAATTTCAACGGAATAAAGGAAAGAGATTGAGATGCTTTTAATTCATAAAGGA
AAGGGAAAGAGGACAGGAAAGCAAGGAAGAGTAATGGAATTTTGCAAATATTTGTAAATC
CTTTAGAATTACTAAGAAACTGTTATTTATTGACATTATTTTACTCGTCTTATTTATTTA
TTTATACATTTGGCCACCATTTTTGCACTCGTACGAAAGACCATTTTAGATTTTTTTGAT
TTGGTAGTATAACAAACGATCGGAACAATAACGTAACATA
Chr coordinates Chr XII from 87403-88155
w3c xhtml validator w3c css validator