Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YLL037W
Strain S288c
Description Dubious open reading frame unlikely to encode a functional protein; overlaps 3' end of essential PRP19 gene encoding an RNA splicing factor
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YLL037w_YLL037w	YLL037w unspliced ORF sequence, from start to stop, size 381
ATGCTTTCTAGGCTTATTCAACACATAACCTCAATTTTCGTTTTCTCATTCTTTTTTCTT
TTTTTTTTTTTCTCACTAAAGCGTTGTCCTAGAGATGTAAAAAGAGAAGGAAATGAAATT
TTTACTGGAAATGTTACTACTATTACACAGGTTTATTTAGAAAGTACAAACGTGTCAGCG
TATTTAGGGTGTCAATGCAACAATATTGAAACTATCATTTGTCTTCAGAATAGCGGCAAT
ACCACCATCTCCGCATACCACGTCCATATCAGTGAAATCGGCAGTGTCGCTTTGCAAACA
GAGGGCGCTCTCCTCGTCTTTAGTCCAATTTTTTGTTTTCTTGTCAAATTTGTATATCGT
CAGCGAATTGCTCTCGTTTGA
Promoter Sequence
Download FASTA
>YLL037W	6322991 upstream sequence, from -1000 to -1, size 1000
TATCCAGGATTATTCTAGAACGTTCTAGAAACAATACTGACCACAAAGACTTTTCGGAAT
AGAATATTGTCAAACAAGAACTTTTTCACTTTCTTTTCATAAAACGTCACTTTCATCACT
TTTGCAGGATTTCCCACAGTTCGTTTAAAGGGACATTTCCTATCATGGGTTGCCCTGCGC
GAATAAGATGATTGGTCAAGGAAGACTCTAAAATCATCTGAACGGGTTATTTGAAGACTT
GGGTCTAAATGAGAGCTTGCTTATTCCACCCGCCACGCCGGGCGTATCTTCACTGTCTTC
TTCGGCCAGGGGATCCAAAGAGAATCGGGCATATTCGTGCGTATTCCTTGTCCGTTGTCT
CTGGAAATCTAAGCTAGTGCTGGTGGTGGGAGGCTTTGCTTTCTTTTCTAAGCTTTGTCG
CGTGAGCTCGCTTCTCATTTCCTCCAGCTTCAAATGGCTATTGTCCGTGGACTTCCTGCC
CGGAGTCGATATGCTTGAGCGGAATTGTATTACATCCTTGCGTTGTTTTTCTAGTAACCC
GTCGTCTTGCAGCAGCCCCAGAACGTTCCTGCTTAGCTTTTGAATATCTTCCGCCTTACG
TTCATCCCGAGGATCCTGAACCTGAAAATCCTCCAGGATCTCAATTAGTATCATGTTTCC
TTTCAGCCACTTGATGAATTCATTGGACCCGTTATTCATCAGATATGAGACCAAAGTCAG
CGTCTTCATCACCTGGATACAATTTCGATGAGAATTTCTTCTGTTCTGCCCAAGTAGCAA
TCGCTTCCGGATTACCTGGATGATTTCTCGTACTGTCTTGGGGCTGTAGGTCAAGATTGA
TATTTCGTTCATAAGCGTCCCCGTTGCTCCACTTGTTTCGTCCTCGTTGGTAGCCTGTTT
CACCTTTGATTCCGTCGGTGATTGAATAAAACTCTTGAAGGTATCTAACAAAGGCATCAC
GACCCCCTCACTATATGTGTACTCGTTCTTTGACACCTTT
Chr coordinates
w3c xhtml validator w3c css validator