Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AQY2
Systematic Name YLL052C
Strain S288c
Description Water channel that mediates the transport of water across cell membranes, only expressed in proliferating cells, controlled by osmotic signals, may be involved in freeze tolerance; disrupted by a stop codon in many S. cerevisiae strains
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AQY2 YLL052C
AGTATTTCGAGGAATATCAGTGTTGGTAAATCTTCTCTCCGGCTCCTTCTGATCCTACGC
CCACCTATATCTACATATATCTACGGCACTAAAAACTTTTATGTACCGCATAAAAGGTGC
TCTTTAGCAACTATTTTTAGTTAATTATTTGCGTTTTAGCTTTCAGGAATTTGCTTGCTA
AGACGATGTCTAATAAATCCGGTACTTCTTTACTTGCAATTAATTACTAAGCGGCGCCTG
AATTTTTCCGGCTTGATGCCGAGCAAAAATTAACTCTAAATCCCTTTCTGGGAACGAGTC
TTTGAAGTTCTACGGTCTTTTGTCTCAGGAAAATATGTCCCGAGAAAGATGGAATAAGTA
TGGATTTTGTCCTTAACCAGTGGAGGTGGCGCTGCAGTCCTTCTTTTCAGACCCAAGCAA
ACAGACCAAAGGACATTTTTTTGGAAAATGTTAAGAATCAACCCTCCGAAATCTTTTCAC
GGCTCAAATTACTGCGGCCTTTTTCTGCTTCTTAAAAATGGGAGCATGATTATTTAATTA
GCATTGCATCTGCGTGCACCGTAACTACTACAGTACTTTTACTGCCGCTGAGACGACAGC
ACGATCTGTTTTAACGTCGTAGGTGTATTTTTTTTTTTCCCGCTAAAAGAGCACCGCCAT
AATAATGACTTACCTCCTCCAATCCTTCTAGATGTTTTTCTTTAAACTCCTACAGTGAAT
TAGATTATTGCAAGTGCAAATTAAAAAAAAACCTAAAAAAAAAAAAGAAGGAAATAGTTT
TTGTCCATACCGGACTATGGCTTTCATTAACGAATTAGAGCGCCGCTGTTATCCTTTTAT
TAACTTTTTATCGTGAATCATATCTGCCCCTCTCTCGGTTGATAGTATAAATATGTTGGT
TTTAGTAGCTTATTAGTGTGCGCATGTCTTTTTTCTTGTTCCTGGCTATTACAATTCCTG
AAAATATTCAAAAGCGACACTAGCCTACCTTAGTTATACT
Chr coordinates Chr XII from 36361-35912
w3c xhtml validator w3c css validator