Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AFB1
Systematic Name YLR040C
Strain S288c
Description Putative protein of unknown function; localizes to the cell wall; predicted to be a GPI-attached protein; upregulated by Mcm1p-Alpha1p transcription factor; partially overlaps the dubious ORF YLR041W; YLR040C is not essential
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AFB1 YLR040C
TGTATAAATATTTAGCTATATATTGAATATCTTGACCAGTAAAGCACCTTGAGAAATTGT
AAGCTTGAAGAACGTACTTTGATATCCCTCCGTTTCATCATCCTATAGCTCGTCAACAAA
TCAAAAAAAATATGAAGATCAGTCAATTTGGCTCTTTAGCTTTCGCCCCAATTGTGCTAC
TACAACTGTTCATTGTTCAAGCGCAACTTCTCACAGATTCAAATGCTCAGGATTTGAATA
CTGCCCTTGGACAGAAAGTGCAATACACCTTTCTTGACACTGGAAATTCTAACGATCAAC
TACTTCATCTTCCAAGCACCACCTCTTCCAGCATTATTACTGGTTCATTAGCTGCTGCTA
ATTTCACCGGTTCTTCATCATCGTCGTCTATACCAAAAGTCACTTCCAGCGTCATAACAT
CTATAAATTACCAATCCTCAAATTCTACGGTAGTCACCCAGTTCACGCCATTGCCTTCTT
CGTCGAGAAATGAAACAAAAAGCTCTCAAACAACTAATACTATAAGTTCAAGTACAAGCA
CAGGAGGTGTAGGTTCAGTCAAGCCATGTCTTTACTTCGTTTTAATGTTAGAAACAATCG
CTTATTTGTTTTCTTAAACAAATATATTAGGTTCAAGGTCTTCGCAGGTGTAAGAAAACC
CGTGGTCTCCATATTCTTAAGTATGATAAATAAAAAAAAACTTAATAAATTATTAATTGC
TTCAAACCTTTTTCTTTTTTTAGTTTTTAATATTTCAAACGTTATCTTCATTGAACGCCC
AAATAGGGAAAAATCCTGGCAAATTTTTTATTGCTGTCATCCAAGGCTATGCTAGAAAAT
TCAAGAGCTTGGATGATTTAAAAAGACACTCTCAATCGAGAAAGTTTATTCTTTGTTATT
CTGCTTTACCTGATCATATTCCGGCGTATTGTTTCTAATCAAGTGATTTCGATATCCAGT
TACGAACCATTTACAACATTCCTGAAAATATTGCGTATCA
Chr coordinates Chr XII from 229582-228908
w3c xhtml validator w3c css validator