Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YLR101C
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the verified, essential ORF ERG27/YLR100W
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YLR101c_YLR101c	YLR101c unspliced ORF sequence, from start to stop, size 396
ATGCCTTTTTTGCTTCACGTGTATATATATCAGTTGATATGCGTTTTCTATACAGACATA
CATGTATATACACACATATATATATATACATATGTACGCAGAGATATATTAAATGGGGGT
TCTAGTTTCAACAATTTGATCTTTCAGTTTCTCGTCCCATTCCAGTTTCTTCTTCTGTAT
ATAAGCGAAGACATCAGACATTCCAGTAGGGTCTATTTCCTGCGTCTTGATATATGGCAT
ACCATCCCTAGAGGTAGCAGAACCGTATTTTACGTCTTGTTTCTCAAAGTTTGGATTGGC
CAATCTAGTTACGTATACTGGGGCATTGGCAGCTTTATAACCATCAATATTGTGCCATGG
AGACCCCAACAGCCTGGCCAAATAGAACAAGCATAG
Promoter Sequence
Download FASTA
>YLR101C	6323130 upstream sequence, from -1000 to -1, size 1000
ATATACCAGCATATGAATATAAAATCTAAGCTTTTTCAAGCTTTTAAGTCCAACTTTTCT
ATAATAATACCATATTTTGTGCGCGGCTCTTGACAAAACAAAAAAAAAAACCTAAATAAA
AGGAAATTAAGAACAGGGAACTAGGTTTGGAAGGACAAATTCAGGAAGGAAAGAAATAGC
TGTGACAAAGTAAGATGAACCAAAATGGTGATAAGAACGAAGGCAAGTTGTTTCAACTAC
CGTCATTGCCGCCCTGGAAAACACCAAGGTTCAACAAAGCCAACTTTAACAATTTTACCA
CACCGCTACGGAAAAGGTCGACAAGGGTAATAAATGATGATTCGATGCCCATAACAGGCG
AAGTACTAGAGGAGAGGACTGCAGATGATCTCTATGGGATAAATATGGACGTAGACGAAG
TCGACTATCTGAATACTTTGAGCCACATCGAGGAAGAAAAGCAATACGATTATTCACCGT
TTTGTGAGCGCAATACGCTAAGGGAAAGTAGAATTGACAGTTTTTTGAAAGCCGAAAGGG
CAGCACATTGTCTTGTGTTTCATAAGGTGGGCCATCTAGACGGCATAGACAGCTATCGAC
CCGATATTGACATCATGTGCGGCGAAGAGGCTAATAAATATGACAGTGCGAATCCGGAGG
GCAATGGTTCAATGTTGTTAGAGAGTGTACCTGGATGCAACAAAGAAGACCTGGAGAGGT
TATCAAGGCGAGAATTTGTAACAAATTCGAAACCTAATATGAGACGGTTGGATGACATAA
TAAATCATGAAACGAACGCCTTAAAAAGTTTCTGGAACGACTCAGGATTAGTCAATTCAC
TCCAAAGTCATCATTTGCATGAAGAGTACCTTCTTTTGCAAGAAGAATTAAAGAATGTGT
ACAAGATTAAATGCCATGACAGAGTGCCAATAGAAAGTCTACGCGATAAGTGCAGAAGAC
ACTATAGCAACGAGGATAGTTCGTTTCTCTGACAGAGGCA
Chr coordinates
w3c xhtml validator w3c css validator