Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CFT2
Systematic Name YLR115W
Alias YDH1
Strain S288c
Description Subunit of the mRNA cleavage and polyadenlylation factor (CPF); required for pre-mRNA cleavage, polyadenylation and poly(A) site recognition, 43% similarity with the mammalian CPSF-100 protein.
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CFT2 YLR115W
TCATCACTCAGATCAGTTGCCCCGTTGGGAGGGCTCCTTTGTCTTCTTTCATCATATAGT
AATGTGAAATAAGTAAATGTTTCTTCAAACGAGTGAGAACCATCAGGAAGGGCCTGGAAG
GGTAAATTTGGCCATAGTTCTGCACTTTGGGTGCCCTCAGGTAAGCCATACCAGTATTCT
ATTTCAGGGCCTCTTTTGTGATGAAAGTCCACAAGGCAGATACCGAAGATGACTGCTTCC
TCGTGTTCATCCATTATTTTGACAACAAGGTTGCAGCGAGGCAGAATGTATATGTTAGTT
TGATATGGTCTTCCTGCTTGGATTCCTTTAAGGCTTCAAAATTTTCTTGAAAAGGAAACT
TCGTGAATGAGCTGTAAGGATGCTTGATCGGGCCGTACATTCTTATGCAAGATCCATTAT
TGACTGCTCTCTGTTGGGTTAGCTTCCATATCTTCCGTTACCCGTTCGTATAATCATTAC
CCGACGGACAAGCATCATTTCAGCGGCTATTTTTGCTAGGCAAACCTCCTAAGCAATGAT
ACTTCTCAAACGTTCAATGGAAGTAATAGAAGTTCAACTTACCCCATTAATAATCCACAC
ATTAGAAGGTTGGGACAATAAAAATAAAAAGCATTAATTAGTGTAAACTTTGCTCCCAAA
TGCAAGTCTAAGGTAAGTTCTTTGGTTCATGGAGTTTTTGCAGTGTAATCTCACGTGCAC
TAGACTGAGTAAAGCGAACCTGAGTTCAAGAAATAATGATTCACCTATGACATATAGTCC
AACTATACAAGCAATGAACCCTTACGGATTGAAGTCATTCAATGTTCAATGTTTGTTGTA
ATAAGAAATATTACTAGAAAAAGATTTTTTCTTTCGGCGGCGTTTTCCCGCTTTTCTTAA
ACAATCTGCAGTTTTAACATCGAATTCACGAATATTTGTTCGCTAAAGAAATAACACAGA
AGATGAAATGAAGAACATACATTGAGGGCGACGAATATAT
Chr coordinates Chr XII from 377985-380564
w3c xhtml validator w3c css validator