Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YLR125W
Systematic Name YLR125W
Strain S288c
Description Putative protein of unknown function; mutant has decreased Ty3 transposition; YLR125W is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YLR125W YLR125W
TCAAAACCGCTAGATAAGCAAATTAACCCAACTTTTGAGCGTCCTAAATTCCCCTTGGCT
CAGAAGACTCGTTAATATGGGAAGTTTAAGTCCTACCATATAATCAAATTGGAAGCTTTC
TGTGTTCGAATGGCTATTCTAACCGCTGGGCTATTAATCAGAGGGGAAGTGAAATGACCG
AGACGTATTATACGTCATGTTGACATCAACAATTTAAGGAAAAAAATAAAAAAAAGCAAT
GAAAAAGGGTTTTTTTAAGTTGAAGACCCTTTTCAAATATATGTTGCTTTGAATTGTATC
TACCGTCTCGTTTCTTCTGCTTTACCGTTTTTTTTTGCCTTCTTTAGATATGTCTTTTAT
GCTTGAAAGGTCCGGCTTTAATGCATTCATCTAAACGTAGTATTCCTATTTTTGAACTGC
TACCAATCCACCATGACTTTACTATGAAGGACATTATTAGTGAACAGCTTCAAAAAAATA
AACTTTTCAAGTCATTAAGATATATCTTGTTGCAGCGTAAGATGTTGGTGTTCAGTGCAT
TCTGTACAAAAATCCGTGTAATACCAAGTCATCCTCAGTTTACAAAGCTTGCTAGTTTCC
TGCAGTTTGGAATGAACCATTAAAGACGCTAATCTTCGGATAGAGATCAGCTCCTTGATA
CTGTATAATCCCTATCCACTTGAATTCCTGTTGCATCCCAGTTCTATAGGCATCACCTAC
TGCATCACCTACTTGTATAATCCTCGAGCAGGTATGCTAGCTCTGCGTCAGTCCTTGCGA
TACACAACTAATGGAATATCTTATGGGTCAATCAAAACCATTCTTCTAGAACGCCGAGTT
TCCAGTTTTGGGATTTAAGTAATACATTAGGTGCCTGTCACGCAATCCGTCCGCTGTATT
TCTCCGCATAGAGGATTTCAGTACGAGAGAGTGAAGAGTCAAACTAACGCAACGTAGTAG
TGGCTTTGGACATTGAAAAGAATAGTCTAGTCTGCCAAGC
Chr coordinates Chr XII from 393484-393894
w3c xhtml validator w3c css validator