Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name EST1
Systematic Name YLR233C
Strain S288c
Description TLC1 RNA-associated factor involved in telomere length regulation as recruitment subunit of telomerase; has G-quadruplex promoting activity that is required for telomere elongation; possible role in activating telomere-bound Est2p-TLC1-RNA
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EST1 YLR233C
TTTCAAACCTGTCTACTACAAAGCCGAGCGTTGGAAACTGGCATGTACCATACGATACGA
CTTGTGAGTCGTTCTTGTTACCACCGCGGTGTTTTGCACCATCCTTGGTCATGGTGGCTT
GGTTTCTCAGTTTATTTCGTAGCGTTTCTGTTAAGAGTCTGGTGAATGTAACACCTGCTC
GAAGATCGATTTCAATCCGCGTGCCTACAGCGTGCACACTCTTCATATCCAATCGACTTG
GGTTTCGTGCTGCATTTAATATGTGTTGTCTTTCGAGATGCGAAAAGACTGCCCGGTATA
CTTGATCATTTTGTATGAGCCTGTTGCCTCTCTTGGCCTCCTGCCATATCTCCCAACCGA
TGTACTCTCCTTCCCGGTCGCAATCTGTCCATATCATCAGATAGTCTGCATTCCTCGCTT
CTCGCTTGATGTTGCTTGCTATCTTTTTTTGGTTGTTATTCATAATCTCGTTCAGTGGCG
CATCAAATAACTCTTGGATGGCGCATTTTCCCCACCCATGCGAATCATGGCTGAAATCAA
TGCCTGTTAGGTGCCCTGCAACACTAGTCATGGTAACTTCGCAGTTAGCCCCATTTCTGG
CAAACGGGAACCCACTAAACATGAAATCATAGTTCTTTACATACATGTAGCCGGAATCCC
TTGAAGTTGATCTGCCTCCTCCTAGGATCTGTGAAACTGCCTTCGCTATAGAATTTTTCT
CTGCGACACATAGCACTTTCATTATTGTCTATAATACACCTTTACGTAGCTGAAGCGAGC
GCACAGACGAAGGTGCTTTCAAAAGCGATGCCCTCTTTATTGACAGTTACTAATTCGCCA
AACTGCTTTTTTTTATCAATGTGATTTTCGCGTTCACGCCATTATCCAATGTCAAAAAGG
ATAATGGAAATGTTAACATGCCTGTATGATCCGACCGTTTTTAGCAAACTTATCAGGGGA
AAAAGTATATTCCATTAAATGACACATGCCACCATAGATA
Chr coordinates Chr XII from 609524-607425
w3c xhtml validator w3c css validator