Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TAD3
Systematic Name YLR316C
Strain S288c
Description Subunit of tRNA-specific adenosine-34 deaminase, forms a heterodimer with Tad2p that converts adenosine to inosine at the wobble position of several tRNAs
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TAD3 YLR316C
GCGACAAGTCCAATACGGTCCCTTCCAATGGTGGGCAAATACTATTCAAAATAGAAACGT
AATTCAAACGCTTATGTCTCTTTAATAGCTTTTGCAGCGTCAAATTAATTCGTACCTTTA
GTCTCTGAGGAATTTTAACCAAATTTGTGGGAAAAATAGCTTCTCTCAAGTCAGTTAGCT
TTTTGATAGATGATGATGAAGGAAGGATCTTGCTATAAGGAAAAAAAGAAGAGGAATTTA
TATTGAGCTTGTGTAAGAATTGTTTATTTGTCACTGGTTCTGTAAGTTGTTTGATTTGCG
CAGCAGTTGCGGATGATGAGGATGATCGTTGAGCCCATTTGGGCGGCAGATGAGGTTCGT
TACATCTGTTACCCACGATTTGAGTGAAAAACTGCCCATTAAATTGAATTACTGTATAAT
TGATCAATAAATCAACGAATGCGTATGTACCGACCAAACTGTGGAACATTTTCCAAGCAG
CGCCTTTCAGTAACGTAACGTTAACATTTGCAGAATGGCAAAAAAGACTATTGTTGACAT
CTTCATTTCTAGCTATTTTATAGCCAAATGTTAGTACGTTGTTGTATAATTCGCCCGTCA
ACAGGTAAATGATGCAGTGATCAATGACTGCTTTGTGGCTTAAGTCACCAGGAAGGCATG
GTAATGCTATTTTTCTTGAATTTGGTAGTGCGAAACACGTAGTTAGAATTTCATCGAGGC
CATTGAAGTGACCACATTTTAAATTTTCTTTGTAAGTACTGTTGGTCTGTAGATCAATGT
CAAGCTTGTCTTGAATGAACTCGAATAAGATTTTCATGAGTATAAATCAGTTTTTTTTTT
TTTTTTTTTTTTTTTAATTTTTCACTTTTCTATTTCACTTGTGTCATTCATTGCCATGCT
TTACTTTTTTTCATTCCTAAATGCGAATCACCAATAGCTCATCTAAAGGTATATATTATT
CAAACCTCAGAAGGATAATATTCATGAGGGCGTGTTAGTT
Chr coordinates Chr XII from 766073-765266,766181-766130,766358-766250
w3c xhtml validator w3c css validator