Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ORM2
Systematic Name YLR350W
Strain S288c
Description Protein that mediates sphingolipid homeostasis; evolutionarily conserved, required for resistance to agents that induce unfolded protein response; Orm1p and Orm2p together control membrane biogenesis by coordinating lipid homeostasis with protein quality control; protein abundance increases in response to DNA replication stress; ORM2 has a paralog, ORM1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ORM2 YLR350W
CTTGGGCATAGGAGCCGCCTGCAGTCTGACTTTGGCCAAGTCAAGAGGATGTGTCACCAT
GGTAGCAAAGATACCCGCTGCACCTCCGTACCACCATGGATACTTGATATTCTTACCGGC
AGACTCTTTTGCGTTGGTTGACATGCCGTCCAGCTGTTGCGTTATCTTTTCGACACTTTC
AGAGCAAGAGAAACGAACCTCTACACATAAATATGCATACGATTATGTATATCCATATAT
ATATATACACTACAAGCCGACCGCCCGACCGTTTCCTGCCCCCAACATTGCAGCGTAATC
GCTTGCCAAAGACCACACCTTGCAGCCCTTTTATACAAACATGTCTACGACGTACAGTGG
AGAGGGCCCTTTCCTTGGCACTCAACTGAGATTGCGACGCGATACCTTCTGCGACCGTTC
CTACTATCGCGGCCATAACTCCAACAACGACAGCGGATGCGCTGTTCTGCGGATGCGTGA
CCGTATCCGCAAAGAACGAAGATTAAATTTAGGGTCCCCGGCATTGAGGATGGTTCTGCC
AAGAACTCACGATATAAACCAGTTGGTTGAGCATCGCATGGATGAGTATGGCGTATTTTG
ATTGCTCATATATAGTGGGGGGGAATACTCATGCTGTGAAAAGCACAACTCTTTTCACTC
AACGAGGTTAATGCCTTCTTTGTCTCCACGCCGTTTTTTTCTGGCGCCCTTTTGAGAAAG
ATAGCCTGTCCCGTAATCGTGGCTTTGGCAGAGACAGAGGGTGAGCGAAAGAGCGGGCGA
AACCGAGAATGGATTCCGAGTAAAGGATTGCGATGGCATGAAACAAAACCGAGAGGCACT
CCTTGTAAGGACACACATACACAGACGTAAACATATATATACATACGTATACTCAAATAT
ATCTTCGTATCATTAGGTCAGCTTCTCTCTTCCGCACGTAGAATTAGAGAATTAACGCAA
GACTATACCATTATAAAAACGCATAAGAAACAGTTTCATC
Chr coordinates Chr XII from 828730-829380
w3c xhtml validator w3c css validator