Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATG23
Systematic Name YLR431C
Alias CVT23
Strain S288c
Description Peripheral membrane protein required for the cytoplasm-to-vacuole targeting (Cvt) pathway and efficient macroautophagy; cycles between the phagophore assembly site (PAS) and non-PAS locations; forms a complex with Atg9p and Atg27p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATG23 YLR431C
AACCAGACCTGGCAAAACCAAAAAGTCGTTATAAGTCAACCCACCTCTGGTCTTGGAGTC
CATCAACTCCTGGACAGACAAACCATCTAGTCTTGGTAAGCTCTTGGCGAATTCCAAGGC
AGTCTTGTAGTCTCTAACGGCGGCCATTGCTTTTACTACTTTCGGAGTTATTAATTGCAC
TGATAATATTTACTGCTGTTAACCTGTCGATGACTTCTTTTCCTTAGAATAAAAGTGAGA
CAGATGAGATGACGTGCTTTTCTGCGAGTTTAGAAAGTCTTTCTAAGTTAAGTTATATAG
AAGCAAGAAAGAAAAGAAATAGAGTAAAAAAGAGAAAGTTCCCAGTACACTAGGTGAAAA
TGCACAAGCCCACGAAACTGGAGTAAACCTCCAAGGGTCCCAACACTCAAAAATCTTGTT
GGATCTCGGAAGGGCAAATTATTCAACTATTTATACCTTTCTATTTCTTCTTTTTTTTTT
TTTTTTTTTCAGTGAAAAATTTTTCATTTTTCGGAAAAAGAAACGTGTGCGGCTTTGAAG
GCTAATATTTATGTAATTAACCAGAGTTAGAAATGAACACAATAGTGGTTAAAGAAGCCA
CTGGGTCACTGGAAAAAAGTACATCTTGTTAGCCATCAAGTAACAGGTTTATGTATTGGG
AATTATGGTTTTTCAAGTTCCCTTGTCTCTTTTTTCCCGATATCCTAGCCCTAGGACAAC
TTGTAGGGTATCAGCGCATATGTTCAAAAAATTTAAGGGCGTAAGCTCTGGCGTTTAGGT
GCGCAATTAACAAAAGGTATAGATAGTCTTTTTATAGTGTAAATCATATACAAATAATAG
AACACAGAGAACGTCTGTATATATCTATTGGAGAACCGGCTAAGGAATGGAAAAGTGAAG
GATAGAGTACGTTTTAGTTCAAGTGATTATTTTCGTTTTCTTGTTCCACATTTTAACCTC
GTTGTTCTATAAGGTAACAAAATAAAGTGAAGAAGTAAAT
Chr coordinates Chr XII from 1001703-1000342
w3c xhtml validator w3c css validator