Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LSM3
Systematic Name YLR438C-A
Alias SMX4, USS2
Strain S288c
Description Lsm (Like Sm) protein; part of heteroheptameric complexes (Lsm2p-7p and either Lsm1p or 8p): cytoplasmic Lsm1p complex involved in mRNA decay; nuclear Lsm8p complex part of U6 snRNP and possibly involved in processing tRNA, snoRNA, and rRNA
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LSM3 YLR438C-A
TGATCCCGTCGATGAAGTTAATGTCGACTGTATTATCCTGGATGGTTTCCGATATGCCGA
AAATGGCCAACTGGAATCGTGTGAGCATGGAGGCGACTTCGTCATCAGGGATATCCTTGT
TCAAGAAGTAATCGTTGGCCAAAGTATCCAAGAACTTTTTCCTCTCCGATTCATCCTGTA
AAAATTCGCGTGAAGCGCTATAGGCCAGCTCTCTTTCGTTAAGTACATGTCTTATTTGCC
ACATGGTGGTTCTGATAGAGTTAGAGAGCTCACTGAATTCGTCATGCGTGGAGCCAACAA
TGTTTTTCAAGAGATGGTTTTCGCGAGCAAGCACATTTTGCTCCCTGAGGCAGTTGTACC
AAAGGGAATGCAAGTCGTTAAAGGACTTGTGCCTCAACTCTGGGATGCTCCAGGGTCTGA
TATGGCTGGAAGGCGGCAAGTCGTCGGCGGACCTGATGAATTTCTTGTTGGAGAAGAACT
GCCACAGCGGGTGGTCGTCGGGACAGCGCAGGTTTGAGGTTGTTGGTGGGATTGGTTCGG
TAATCCTCAGGTTGTTGGAGTGATGAGTCAATTGAGTGGGCGGTCTTATTTTGTCTTTGG
GAAGCACCGGTTGTTTTGGCTTTGGTTTGGTAAACTTTGTTCTGGCACGCAGGGGCCCTC
CTTGGGAGTGGAACGATCTCTTCCACATTTTTATTATATTTTTATGGTATTTTTTTCTAG
CCGCAGAGATAGAATGGTACTCTCTTACCAGGGCTCGATAGCTTTCAGGGCAATTCTTTT
AGTTTGCTGAAATGATATTTTTTCTTCTTCCTGATGCGCCCTTTTGGCTATCCGTGCTGT
GTGATAGGTCGCGATATTGAAAGAAGAAAAAAAGCAAGAAAGCTGAGGTTTGAACAAACA
AGAGGCAGGATGTTTCCATCCATTCTAGCAACCAATACAACAGGGGAGAGACACGCAGAT
AAATACACACACACACACAACATCACGCACACTCAAGAAA
Chr coordinates Chr XII from 1014178-1013909
w3c xhtml validator w3c css validator