Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LSM3
Systematic Name YLR438C-A
Alias SMX4, USS2
Strain S288c
Description Lsm (Like Sm) protein; part of heteroheptameric complexes (Lsm2p-7p and either Lsm1p or 8p): cytoplasmic Lsm1p complex involved in mRNA decay; nuclear Lsm8p complex part of U6 snRNP and possibly involved in processing tRNA, snoRNA, and rRNA
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>LSM3 YLR438C-A
ATGGAGACACCTTTGGATTTATTGAAACTCAATCTCGATGAGAGGGTGTACATCAAGCTG
CGCGGGGCCAGGACGCTGGTGGGCACACTGCAAGCGTTCGACTCACACTGCAACATCGTG
CTGAGTGATGCAGTAGAGACCATATACCAATTAAACAACGAGGAGTTGAGTGAGTCCGAA
AGACGATGTGAAATGGTGTTCATCAGAGGAGACACAGTGACTCTAATCAGCACGCCCTCT
GAAGATGACGATGGCGCAGTGGAGATATAA
Promoter Sequence
Download FASTA
>LSM3 YLR438C-A
TGATCCCGTCGATGAAGTTAATGTCGACTGTATTATCCTGGATGGTTTCCGATATGCCGA
AAATGGCCAACTGGAATCGTGTGAGCATGGAGGCGACTTCGTCATCAGGGATATCCTTGT
TCAAGAAGTAATCGTTGGCCAAAGTATCCAAGAACTTTTTCCTCTCCGATTCATCCTGTA
AAAATTCGCGTGAAGCGCTATAGGCCAGCTCTCTTTCGTTAAGTACATGTCTTATTTGCC
ACATGGTGGTTCTGATAGAGTTAGAGAGCTCACTGAATTCGTCATGCGTGGAGCCAACAA
TGTTTTTCAAGAGATGGTTTTCGCGAGCAAGCACATTTTGCTCCCTGAGGCAGTTGTACC
AAAGGGAATGCAAGTCGTTAAAGGACTTGTGCCTCAACTCTGGGATGCTCCAGGGTCTGA
TATGGCTGGAAGGCGGCAAGTCGTCGGCGGACCTGATGAATTTCTTGTTGGAGAAGAACT
GCCACAGCGGGTGGTCGTCGGGACAGCGCAGGTTTGAGGTTGTTGGTGGGATTGGTTCGG
TAATCCTCAGGTTGTTGGAGTGATGAGTCAATTGAGTGGGCGGTCTTATTTTGTCTTTGG
GAAGCACCGGTTGTTTTGGCTTTGGTTTGGTAAACTTTGTTCTGGCACGCAGGGGCCCTC
CTTGGGAGTGGAACGATCTCTTCCACATTTTTATTATATTTTTATGGTATTTTTTTCTAG
CCGCAGAGATAGAATGGTACTCTCTTACCAGGGCTCGATAGCTTTCAGGGCAATTCTTTT
AGTTTGCTGAAATGATATTTTTTCTTCTTCCTGATGCGCCCTTTTGGCTATCCGTGCTGT
GTGATAGGTCGCGATATTGAAAGAAGAAAAAAAGCAAGAAAGCTGAGGTTTGAACAAACA
AGAGGCAGGATGTTTCCATCCATTCTAGCAACCAATACAACAGGGGAGAGACACGCAGAT
AAATACACACACACACACAACATCACGCACACTCAAGAAA
Chr coordinates Chr XII from 1014178-1013909
w3c xhtml validator w3c css validator