Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MRPL4
Systematic Name YLR439W
Alias uL29m, YmL4
Strain S288c
Description Mitochondrial ribosomal protein of the large subunit, homolog of prokaryotic L29 ribosomal protein; located at the ribosomal tunnel exit
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MRPL4 YLR439W
CAACTGGGTAGCTCTTTCATCGCCCAATTGAAAGCTCTCCAAGCCAAATCTAACGGTATA
ATCTCTGAGGTGCGTGGTATGGGACTGCTTACCGCCATCGTAATCGACCCATCCAAGGCC
AATGGTAAGACCGCTTGGGACTTGTGTCTATTGATGAAGGATCACGGCCTCTTGGCTAAG
CCCACCCACGACCACATCATCAGATTGGCTCCTCCTTTGGTCATCTCCGAAGAGGACTTG
CAAACCGGTGTCGAAACCATTGCCAAGTGTATCGATCTGTTATAATATTAATACGCATTT
TTTTTATGTTTTCTCGTTTCTTTTCTTTTTTTTGTTTTATATCTTACACATTTTTAATAT
ACTAAAAGTAAAATAAAAAAATACGTACTGTTTCCCTTTGTTTTCTCCTCCTCTTTGCTT
ATATCTCCACTGCGCCATCGTCATCTTCAGAGGGCGTGCTGATTAGAGTCACTGTGTCTC
CTCTGATGAACACCATTTCACATCGTCTTTCGGACTCACTCAACTCCTCGTTGTTTAATT
GGTATATGGTCTCTACTGCATCACTCAGCACGATGTTGCAGTGTGAGTCGAACGCTTGCA
GTGTGCCCACCAGCGTCCTGGCCCCGCGCAGCTTGATGTACACCCTCTCATCGAGATTGA
GTTTCAATAAATCCAAAGGTGTCTCCATTTTCTTGAGTGTGCGTGATGTTGTGTGTGTGT
GTGTATTTATCTGCGTGTCTCTCCCCTGTTGTATTGGTTGCTAGAATGGATGGAAACATC
CTGCCTCTTGTTTGTTCAAACCTCAGCTTTCTTGCTTTTTTTCTTCTTTCAATATCGCGA
CCTATCACACAGCACGGATAGCCAAAAGGGCGCATCAGGAAGAAGAAAAAATATCATTTC
AGCAAACTAAAAGAATTGCCCTGAAAGCTATCGAGCCCTGGTAAGAGAGTACCATTCTAT
CTCTGCGGCTAGAAAAAAATACCATAAAAATATAATAAAA
Chr coordinates Chr XII from 1014491-1015450
w3c xhtml validator w3c css validator