Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MIN4
Systematic Name YML007C-A
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to mitochondria
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MIN4 YML007C-A
GCTAAATATTCCAGCACTTTTGAGTCATTTCTTGTCTCTGGTCTATATTTTTTTAACTCA
TTCACCAGAGTGATTAACTGGTCCCTCAAAAAAGTAGCTTCCACTTCATTTTGCTGCTGA
ATACTCTCTAAACTTTGTACCTTCTTCTCCAATTCCTTCATCTTCCTCTCCTTACGTTCC
CTAAAAGCTCTTTGAGCGGCCCGATTTTGGGCAGTCCTCTTCTGCTTAGTTTCAGGATCC
AAATCTTGCTTTTTGCTAGTTTTGCTACCCTTCTTCTTCGGTTGCTCGCTATCCTCGCCA
TCACGTGTACCAGTACGTCTATGTTCATTTTCTATTTCATCGTGACGAGATTTTGAACCC
TCAAACTCCGCTAATGAACCCGGAGAAACGACATCCAGCGACCTCTTGGCGGTAGACACA
CTCATGGTTTAAGAAACAACTTTTCCTTCTTTAAACGTTTTGGGTGGCAAAAAACTTCCC
TTAAACAAACTAAAAATGGCTCGTGTTCATGCACAAGTCAACCAGGGGCTCAGGAAAAAA
AGCTAAACACCAATCCTATATATAACGTAAAGGTACTGTGCTTAATCGGTAAACGGAAGA
CTATTAAGCAAATGTATCTCTTAAGACCTTACGCATCCATCAGTTGCCACCCTCCTACTC
TTCATCGGAGGGTTTCCGGTTCCCATGACAAAGACGGCGCTTTGGCGGGGCCCAAATTGT
TACCCGCACCCAGAAAAAGAAAAGAGTAACCTAGGTCAAATCAACCAAACAGCTAGGGCT
GGTTACTATTTTTGAAAAGATGCAACAGGGTAAGATCAGCAAAATTTAGGGCCGAACAAA
GCCCCGATCTTCGTATATGGTACCTCGTTCCCGTACTTATTTTCAATTTTTGGCGTCGTT
TACTGCCGTTTCCGATAAATACAAAAAAGTTTTCGAGAAGCGAGAGTAAGTGAGGAGCAG
ACAATGTATTATTCACTGTAAACTGCTCCACTTCGTCTCA
Chr coordinates Chr XIII from 253272-253162
w3c xhtml validator w3c css validator