Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name UNG1
Systematic Name YML021C
Strain S288c
Description Uracil-DNA glycosylase, required for repair of uracil in DNA formed by spontaneous cytosine deamination, not required for strand-specific mismatch repair, cell-cycle regulated, expressed in late G1, localizes to mitochondria and nucleus
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>UNG1 YML021C
TTCCACTTCCAAATTGTGGATGTGACTGTATTCCATATGGTTTGTTTCGGTAAAATATCG
AAACTTGGTACAACAATGTTAGGAAACTGATTGCCTATGTCATCTGTTAATTTCTTAGCA
GTTTTGACACCTTTATCTCTGATCAATATAGCATCAGGTTTATAAGGTATGTAAGTGTTG
GTTAGAGGAGCCGGATTTAGACTATTTGCTAAACGTGATAAAGTGTTATTATCCGCATCA
GTGGGAATGTTATGCGTCGGCTCCGGATCTTTTTTGTTACGGCCCCAAAAGAATGGCCAT
GCTCGTGGTCTTGTGTTTTTTTCTACTATAGCTGCATTTCTGTCTTTTTTGTCCTTCTCA
CCCTTCTCGATCCTGGTGGTTTCCTTTAAAATCGTTGTTTGTTGATTATCGTGCAAGCGT
GTTCCCTCATTTGAAACATTGTCATTTTCTTGACTGTTGTCTTGGGCGGTTTCCTTTCCT
TTATTTTTATTAGATAACTCCGGTTCTTCCTCGTCATTACCTCCCCATATAGACCAGGAT
TTGGTTGTTCTGTGCTTAGGCTCACTAGGCCCCATACGACCAGACTGAGTATGTACTGAG
CGCAGTGAGGTCGTTGAAGATTTCAGACTGCTTTTCGGCGAGGAATGCAATGGAGTCGTG
ACCATTCTACCTACTGGTACTCTGTATATAAGTCTCTTCCAATTCTTCGTAATGGTGTCT
ATTTGTAGTGCAAAAGTGCTATCCAAGAGCAGTGATAAGCCCACTATATGTATAAAGCCG
AATCTAGTGACTGGTGGGAATAAAAAAGATAGTTTTCGAACTATTCTTATATGAACTTTC
CATGGAATTACCTCACGTTGTTCACATTAGTGACTTGTAAAAAGCTTTACATATAAACTC
AATATTTTCCCTATTGTCAAAACCTGGAATGTGTCCGCAACGCGTAATTCATCCATAATG
ATATATATTATCAGAAGCTGTACACAAGCCGTTCACATAC
Chr coordinates Chr XIII from 230813-229734
w3c xhtml validator w3c css validator