Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ERV41
Systematic Name YML067C
Strain S288c
Description Protein localized to COPII-coated vesicles, forms a complex with Erv46p; involved in the membrane fusion stage of transport; has homology to human ERGIC2 (PTX1) protein
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ERV41 YML067C
TTGGATTTTGTAAACGGAGTAATAAAAGCAAAGTTTATTGTACCTCTAATGAGAATTATG
GCATGGACGTACTTGAAGTACTTGTCAGAGACGTCGGGATTCAATTAGGTAACATTTCCA
CTACACGATCGAATGAAACCAAAAAATTCGGAGACTCTCTCGTATTGACCTACCGTTTGG
CATTGACATCTATTCGTGATTTTTTGAAACACGACAAGCACACAGGAAATGCCCTATCAA
AGGCTTTGATTGGCAGTCCTGATCCAAATGTAAAAGGCGTGTCACCAACAAAAAACTATC
TGAAAGGCGTCAACCTGGCATTTATACTGATGATGTTCAACGGCATGGTTTTTTACTTTG
CAGTGTTGGAAATAATAGTCGGATTCCTCAGTATCTGCGTAGTGTCAGCCTTTGGGGGAG
CACTTAGTGTTGGGAAACGACACCGCTTATTTCCTATGCTTTTGAAGTCATCAAGTTCAA
TATTAGTTGTTATTGCTACATTGACAATATTATGTAACATCGTATATTTGATTGCACTGA
AAACATTAGAACCTGAAGAGGTAACAGACGTAGGATCTGACAACGCTGCTGTACACACTA
CAGGCTGGGAACTGTTAAAAGTAAACGTGGGAAGTGGGTTCATTATGGGGCTCGCCAGGT
ATGCCATCCAGTGGGTCCTATTGGTACTCGCATTTCTTGCAGCAAATCATTACAAAGCTA
AGCCCAAAAAGTCTGATAAGTATACAGAAGACACATCTAACTCCCCTTCTCCAGACTTGA
TGGAGAAGTAATTCACCACAGAACTTTTTTTTCAAATGACAGTAAATATGTAAACATATA
CACAGCCTTTCAGTATATTAAGTATTTTTGCATAACGTCCTTTTTTCCCGCTCGGTCAAG
GCTTTGAAAAGATATTATCAATGTTCTATTCTTACTGAGAAAAGCGTTCCTCCAAAATGC
TTTTGCTGTAACGTACAGGCAGAGACTTCAGGAGTATATA
Chr coordinates Chr XIII from 140090-139063,140214-140184
w3c xhtml validator w3c css validator