Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name VPS9
Systematic Name YML097C
Alias VPL31, VPT9
Strain S288c
Description A guanine nucleotide exchange factor involved in vesicle-mediated vacuolar protein transport; specifically stimulates the intrinsic guanine nucleotide exchange activity of Vps21p/Rab5: similar to mammalian ras inhibitors; binds ubiquitin
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>VPS9 YML097C
CCTGAGAATAGTACCGCAATAGGAGAGTTTTCAATATGCCTGGGATGTATGGACTCTACC
CTTTTTTTTACAGAATCACGTAGCACAGCATATAAATTTTTAGACACCTCTGACAATGAT
GTGAAATTCAGATCTATCTCTGATGTCACTTCGTATGGAAGATGTGACCTCTGATTGGAA
TTTAACAACTTAGTTCGTGTATCATATTCATAAATAACTCCACCTATACAATCTTGAAAG
GACCCAGCAGACCCCGTTACACTAGCGACGTACAATTCGTTGTCTGGAGTGACCGAATAA
GACAAACTTCGCCTGCCAATTGGATCTCTGCCGAAATAGAGTTTGGATGAGTTCACGTCA
TATATAGTATAAGCATACTCGCCTTCCAGTGATTTTATAACATCAATAACGCCCATACCC
TCTTTCAAATTCTGCAACATAGAAGCAATATAAAGACTATCATTATCACCCTGCGATATC
TCTTTATTGTATAACTCACCATTGAATTGTAGGAAATATCTGTCATCCACGTTAATACTC
TGTTTCGTGAAAGGCTGCCTCAAAGATAAAACAGAAGAAAACCAACTTATTCGATAAGCT
TTGACAGCTCGAAGAGAGGAGTAGTTTGGACCTCTTGCGGCTATGTACGGAATGATTTTG
TTGAAAATCGACGATTCATTGGTACATGTTGTATCTCCAAATTCAGTTCCTTCTGGAAAT
TCGATTAACTCATCATTCAGGTAGTTATTGTTTGGACAATAATGCAATAGAATCCCGCAC
ATGTCTCATAGTAATGCCAGATGCTCAAGGCTTTACTAAATCTGGAACTTTCCGATGCCT
TAATATTTTTCACTTTTCTTTCTTTTTTATTATTTTTTTCGCGAATGGGCTATATCAAGC
TGCCGGTACTTGATGTAATGACACATAACATTGAAAAGTTCTACATCCAACGGGCTTGAG
TTTCTCTTCATCAAACAACAAAGAACAGGAATCAACAGCC
Chr coordinates Chr XIII from 79690-78335
w3c xhtml validator w3c css validator