Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CDC5
Systematic Name YMR001C
Alias MSD2, PKX2
Strain S288c
Description Polo-like kinase essential for mitotic cell cycle; controls targeting, activation of Rho1p at cell division site via Rho1p guanine nucleotide exchange factors; regulates shape of nucleus, expansion of nuclear envelope during mitosis; implicated in cell divisions in telomerase-negative strains through adaptation to DNA damage, which allows bypass of cell cycle arrest and contributes senescence-specific genome instability; human homologs PLK1, PLK3 can each complement cdc5 thermosensitive mutants
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CDC5 YMR001C
TTAATCCTTTTTCTTAAAGGTTATAAACTGTACGAGTGATAGGCTTATATAGGTCGCGGA
GATTGCGGTGGAGTGAAAAAGCGCTTTTCTTTTATACCTTTGTTCAAGGTGGCGTTTGCC
GTATAAAAGCACACATGACATAACCGAACCTCGGAAAATGAAGTTGCACTGTTATTGCCT
TCCAGATGTGTAGAATCATCACCATCTTCTGTGATAAATGAAGAGGGAATCGTACGAGGA
CGCCAGCATATTTTTACATCAAAATTTATGTTATTGTTGAAGGAACATTGAAAAGATAGG
GCGGGCAAAATCTGCGATCAAGCCTATCCTCTTTCATCTCAGCTGTTCTAGATGCGTTAC
CCGGTGGTAACTTCACTGCATATTATTACTTTATATACCTTATTCTATATGTTGCCCGGG
TAGGGCATTATGTAGCATCACCCGGAAGAACTTTTGGACTTTTCTCTGTCAAAAGATATT
ACCTAAAAGGGTCAAAACAAAACAAACCCAATAAAGAAAATCCAAAATATAGAACGAATA
AATATCTCGAGGACCTGGGATGATCTTTGAATGTACATCCTTTGAAACAAGGCATATCTT
GAACAGTTACTCTTGTGCTACTCAACTTTCGTACAATACATATAGAATCACTGAGAAAGT
AAATCCAATTCAAGCGGCAGTTTCAAAGAACAATAAGCCTTTTGTGTCAAATTCTGATTC
TGCTTTTTTTCCTATTTTTTCATCCTTCAATTTTGTGGCATATACTACATTAACTTTCAA
GAAAACTTAAAAAAGAAAAGACAAAAAAGCTAAACTGCATAGTCAAGTTTGTATAATTGA
GCTGAGTATTATTTTTTGTACACAAAAACATTGGCTTTCTTATATCTTCTCTATATATAC
TCTCTTTCATTCATCGATAAACGTTACATTTGTTATTCATAGAGAATAAAAATCACAGCC
GTGGAGAAGAAAGAACAGAGTAAGATCAAGTCGAATAAAG
Chr coordinates Chr XIII from 271136-269019
w3c xhtml validator w3c css validator