Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ARP9
Systematic Name YMR033W
Alias RSC12, SWP59
Strain S288c
Description Component of both the SWI/SNF and RSC chromatin remodeling complexes; actin-related protein involved in transcriptional regulation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ARP9 YMR033W
AACGCCTAACTCTGCGCACAACCTCAATGAAGATGATTATAACACGAGGAGAGATACCAG
TACAAGCACAATTTTGTTCAAACCTCCTGTGGCAGTAAGAGGAACGTCTAGGGGGCACAC
GCATAGACAATCCATGATAATGCAAGATTCAAGTAATCCAATTGAAGATGCCTTGTACGA
AATGGAAAGAATCCAAAGTAGTTCTAAACCAGGTACAAAAACAGGAAACATCATGGATGA
GAGAGGTGTGGTCAGGGATAGAGGTATTACTGTTACCTTGCCTATTGTCACCAGTGAAGG
TTTTCCAGTCATTGAATATGCCAAGGCCATGTATCCATTGATTGGAAATGAGGCACCTGG
ATTAGCGAATTTCCATAAGGGCGACTATCTGCTAATTACTGAGATTGTTAATAAAGATTG
GTATAAAGGTGAAGTTTATGATAATGACCGTATAGATAGAAATCATAGGATAGGATTAAT
TCCCTATAATTTCATTCAGCTACTGCATCAAGGTCTTTGATCTCGATGTATATCAATTTT
ACTAGTTTTCTGATAAAAGAAAAAAAGTATAATGTCAGATTTTTGTTAAGTAGAAATAGA
AAGATATACGCTGCCGTGGGAGAAGGACACCTCTCCGGATTTGTAACTAAAAATCATAAA
ATATCACGTCTTTCCTTCATATTTTCAAAAAAAAAAAAAGTTTTCTTTACCATTTTTGAC
ACAATAATCACGATAATTGTTAGGTCAGGCATTCCCTTTCCACTTTTATGTTCATTTGGA
CGCAATAAGATATACATATTATTTAATGTGCTCTAATGACAGTTCTACTGTGTTTATATC
ATTAGAGTCACTTGTTACGAATACTACATATTTCCGCGCAGTGGCTAAAAGCAAATTTCA
ACATTATAAATCTCTAATAGTAAACTGACAATATTGCGGAATTAGAAAAAATGTACCACG
CGAAGTTAAGTGTCTTGAACAACTACTATATGCATTGAAT
Chr coordinates Chr XIII from 337788-337817,337904-339277
w3c xhtml validator w3c css validator