Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YET2
Systematic Name YMR040W
Strain S288c
Description Protein of unknown function that may interact with ribosomes, based on co-purification experiments; homolog of human BAP31 protein
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YET2 YMR040W
ATGGGTGTTTATTTGGCAGTACTCTTTTCGTTACTGGTCATCGAAATGGCCATTCTGTTT
ATTTTGGTACTTCCGCTTCCACAGCGTATGAGAAGGTGGCTGTATATACGCTACAGTATC
ATAAGTACTAATAAGAAATTCAGAACTTATATGGTTGGAATCATGATCTTCGTTGGTCTT
TTGTTCATCGATTCATGGAAAAGGTCACAGATCAGAGTGTCTACGTACCGCAACCAGAAA
AATCCCTATATAATAAATAGTGTAACCCCAGTGGATGCACTGGCTTCAAGGGCATATAAC
CAAAGGAATGTTTACATTTCAGGCTTCATCATCTACTTTTATATATGTATACTCACCGTG
ATGAGTATATTGCGAAGAATAGTGGAATGGAATGACAAAATGAAGGCTGGAGATGACATT
CTGAAGGAAAAGTTAAGACGAAAGCAAAAATATTTAGAGGAATTGCAGAAGAAGAAATTT
TAA
Promoter Sequence
Download FASTA
>YET2 YMR040W
TCTTATTTTTACCCAGATCAAAAATTGCATCTGATGCGGATAGTCCAGATGGCATACCAC
CATTGTTATTGTTACTGTTACTTAAGTTTCCTCCACCATTATCGCTTCTTCTTTTGTTCC
TATACCTGTTGTAATATGACATAGCGCTTGTGTTTGTATATATGTCGAAAAATTGATGTG
TACGGAAAGATTTAATATTAAATAGCTTTCTTAAGTGGGCAACCAAAAGTGTTTCTTTGA
TTGGGGACTTTTACAAAATTCACGTTTACAACCTCTTCTCTTGTCTTCCTATCGTTCCCT
GGATCAAATTAAGAATTTTCATCAAGAATAGAGAGCAGAAGGCAAGCCAAGAGAGAAAAA
GAAAGAGAGAAAGAAAGAAAGGAGAGGAAGAGGAGATGAAAAGAGAGGAAAACTTGAGTT
TTGATAAAGAAATTTGAGGAAGGTAAAAGTAAAATTCCCATTCAAATGAATGTATTAATA
AATTCTCATCATTAAAAGGAGGGAAAAATTACGTATAACGTAAAGATAAAACGTGTGTGT
GTGCAGTGCTATACTCATTGTCCTTGTTAGTGATGATAATTCGTCCCAGCTGAAAAAACT
CAAAATAAGTATTACCCGGATCGAGGCTGTGGCATTTAGCGCCGCTGTCTTGACCATCCA
CCAATGGTTGATAATAACATCGGATGATCAGCCCATTTTTGGTGTATTACTATCCCATCT
CATTCTTCCAAAAAACACGTATATATCATTGACGAGATCGAGATACGTCTGCTGTGTTTA
ACGGCTAACTTGGTTGTGTAGGCTTGTGTCAATTAGGCAAAATGGTTTTCTTGGAAAAAA
GACAAGGGAAAAAAAAGGGTTGATAGAGCAATATATGTACAGCTGGCCTTCTCTGAGAAA
AGCTAGCCGCCTGGAAGTAAATAAATACGCTGAGTGTTCGTTGGAGCATGAATTATGTGA
ATAGAAAAATACTAAGCAAAATTTCAAAGTCGAGTTAGTG
Chr coordinates Chr XIII from 350381-350863
w3c xhtml validator w3c css validator