Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CTF13
Systematic Name YMR094W
Alias CBF3C
Strain S288c
Description Subunit of the CBF3 complex, which binds to the CDE III element of centromeres, bending the DNA upon binding, and may be involved in sister chromatid cohesion during mitosis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CTF13 YMR094W
GCGTTGATCGCTTCTTCCTTAGATGGTCATGTCAAAGTCTTTGATCCTTTAGACAATTTC
CAAGTCAAATTTGGCTGGAAATTTTCGGGTCCCGTACTAAGTTGTGCTGTCTCCCCTAGT
ACCGCACAAGGGAATAGGCATTTAGTAGCAGGTTTATCATCAGGACTACTAGCCATTAGA
ACTAAAAAGAAAGAGAAACGTTCTTCCGATAAAGAAAACGCACCCGCCAGTTTTAATAAG
AATGCGAAAAGTAATAACTTCCAGAGAATGATGCGAGGCTCGGAATACCAAGGTGATCAA
GAGCATATAATCCACAATGATAAGGTAAGATCTCAACGTCGTATGCGTGCATTCGAAAGG
AACATAAATCAGTTTAAATGGAGCGAAGCACTCGACAATGCCTTTGTACCAGGTATGGCC
AAAGAGTTGACACTTACTGTTCTTCAAGAACTACGCAAACGTGGCAAAGTTCGTGTAGCG
CTATATGGTAGAGATGAATCTACATTAGAGCCGCTACTGAATTGGTGCTTAAAAGGTATT
GAAGATGTGAGATCAGCATCTATTGTAGCGGATTGGGTCGCCGTGGTTTTAGAATTATAT
GGGAATACGTTAGAAAGCTCTCCAGTTCTTCAAGAATTGATGATAGATTTGAAAACTAAA
GTTAGACATGAAATTCATAAGTCTAAAGAAGCTCAAAGAATTGAAGGTATGCTTCAACTT
TTAACGAGTTAAGGAAATATTAGCATATAGATTTTAATTTGTATCTATTTTATAGATATT
CAGGCATACATATATATCTCTTTCTCATTGTAATCGAAAAAAATAATATCTTCTCTTTTT
ATTGAAAAAAGGAACCTGTATAAATTTCATTTTAGAGTGCTTTGCATTTTGATACGTTTT
CGCGTTTAACTACCTTCGAGGGCTTGAAAACAAAACATTGTGAGATGAGATGCTATCAAC
AGAAAGCTGACTGTGAGTCCCCAGAAGTCCATGTCGCTTG
Chr coordinates Chr XIII from 455825-457261
w3c xhtml validator w3c css validator