Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name Uncharacterized
Systematic Name YMR173W-A
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; overlaps the verified gene DDR48/YML173W
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>YMR173w-a_YMR173w-a	YMR173w-a unspliced ORF sequence, from start to stop, size 1185
ATGACAACGACTCCAACAACAACGACTCATATGGTTCTAATAACAACGATTCATATGGTT
CTAACAACAATGATTCATATGGCTCTAACAACAATGATTCATATGGCTCCAACAACAATG
ATTCATATGGCTCTAACAACGATGATTCCTACGGTTCTTCCAACAAGAAGAAGAGCTCTT
ATGGTTCTAACAATGACGATTCGTACGGCTCCAGCAACAACAATGACTCTTACGGTTCCA
ACAACAATGACTCTTACGGTTCCAACAACAATGACTCTTACGGTTCCAACAATGACGACT
CTTACGGTTCGTCAAACAAGAATAAGAGCTCTTACGGTTCCAACAATGACGATTCTTATG
GCTCTAACAATGATGATTCATATGGTTCTTCCAACAAGAAGAAGAGTTCTTATGGTTCCA
GCAACAACGATTCGTATGGTTCTAACAACGATGATTCATATGGTTCTAACAACAATGATT
CATATGGCTCTAACAACGATGATTCCTACGGTTCTTCCAACAAGAAGAAGAGCTCTTATG
GTTCTAACAATGACGATTCGTACGGCTCCAGCAACAACAATGACTCTTACGGTTCCAACA
ATGACGACTCTTACGGTTCGTCAAACAAGAATAAGAGCTCTTACGGTTCTTCTAGCAACG
ATGATTCTTACGGATCTTCCAATAACGACGACTCTTACGGTTCTTCCAACAAGAAGAAGA
GTTCTTATGGTTCCAACAATGACGATTCTTATGGCTCTAACAATGATGATTCATATGGTT
CTTCCAACAAGAAGAAGAGTTCTTATGGTTCCAGCAACAACGATTCGTATGGTTCTAACA
ACGATGATTCCTACGGTTCTTCTAACAAAAAGAAGAGTTCTTATGGTTCCAACAACGATG
ATTCATACGGCTCCAGCAACAACAATGACTCTTACGGTTCCAACAATGACGACTCTTACG
GTTCCTCTAATAGAAACAAGAACTCCTATGGGTCTTCCAACTACGGTTCATCCAACAATG
ATGACTCTTATGGTTCATCTAATAGAGGCGGTCGTAATCAATACGGTGGTGACGACGATT
ACTAAGTTTTTGGATGTCTTCGATAAAAAAAATATATTATTGTGTTTAGACTTAAGTATG
AAAATTTTATGTATGAGCTGTGGCTATGTATCCGCTGGCAAATAG
Promoter Sequence
Download FASTA
>YMR173W-A	6323827 upstream sequence, from -1000 to -1, size 1000
AAAGCCATCGATCAAGCATCTTGAGGCCAAGTATGGTAACAAGTGGAGGCTCAATAAAAA
TAAGAAGACCTTTTCAAGGCGAAAAAGATTGTACAAGTTCATTCTGAACGGTATGGAGAG
AGGTAAAACGGCACAAGAGATGATAGAAACCTTAGAGAACAAAAGGCTATATAAAGATGA
TGAGGATGGCGAAGTAAAGAAAAGAACCATTGGCTGGTTGCAAGAGAGCCTTGCTGGAAT
ATAGGCACGTACGATAGTAAATAATCGTTTACAATCATAGGAAGGAAGGAAAAAACAAGT
GTAACATAAATACATTCTGTAAATCTACAAAAATCGTTAGTGCTGTTTTCTTTTTGAGAT
TGAAAAGTACGAATCATACACATCTCTTATTCTGAGAAGGGTGCATATGACGTAAATCAA
TGCGTACAAAGCGGTTTCCGGTGCTGGCCTGGCCCACCACAGTTTTGGCGTGGTTGATTT
TAAAAACCTTCGGGAAGGTGAAAAAACCACTCCGAAGGTTCGAGGATGACAAATCGCCCC
TTAGCTGTGGCCATACAAGCTTGGCACCGACGAAAAAGGGAAAAAGGAAAAGAATGTCGT
ACAAGAACTCTTACAACCACGTTGAGATTTCATTTAACAACGCCCCCCTTTCCATTATAT
AAGAAGGCATTAATTTTTATGTAATAAAAAAAGAATTTCTCGAAAATGTCTTACAATTAA
TTTTTTCTTTTGTAGAGTAGGGCTTTAATAGACTGATATATACGGTATTATAAGTGAACG
AAAAAAACAGCAATGGGTTTATTTGATAAAGTGAAGCAATTTGCTAACAGCAATAATAAC
AACAATGATTCTGGCAATAACAATCAAGGCGATTATGTTACCAAAGCTGAGAATATGATC
GGCGAAGATAGAGTCAATCAATTCAAAAGCAAAATCGGAGAGGACAGATTTGATAAGATG
GAGTCCAAGGTTCGTCAACAATTTTCTAATACCTCTATAA
Chr coordinates
w3c xhtml validator w3c css validator