Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MRPS17
Systematic Name YMR188C
Alias uS17m
Strain S288c
Description Mitochondrial ribosomal protein of the small subunit
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MRPS17 YMR188C
AAGAAGTATACCATTCTGGACTTTCTAGCAGGTTTCTTTGTATAACCGGTGGTAAAATCG
TACCGTAGTAACCCTTACCTATGAAATTTTTAACTTTATAGTGGTTCTTATTGGCAATCT
TTTCTAGATGTTGAAGCATTTCTTGTTCACAGAATCCCTTACTAGGAGCTTCTAGTTTCA
AGGGTCTTCTCTTCAAAATATTGGGAGGAACGAGCTCTTCTATAAATGCGTTTAAATCGC
TATAACCCATTGTTTTTAACATTTTCTTAACGTCGCTAGGAGAAGGACCTAAATGACGTC
TAGCAAAAGTATCTAGCGGTCTATCAATGTTTTTCAAGTCAGGATTGAAAATCCTGCTGT
ACTGTGTAGACGTTATGTCTGTAGCGGCTGTTTTGAGCAAAATAGATTGAGAATGGAATG
ATCTAGTCCTCGCTAATGAAACATAATTGGTGCTTGACCTGACAGTAGCCCTACAAAGGA
GAGCAGTCACTCTTGTCCTAAGCATGTTATCTTCCTGGTATTAGGAAACGTTTTTCCAAT
AAACTGTGGTTAGTTGATGGTTAGATCGCGCAGCAATCAATACAGTAAGATTGGTACACA
CGAGAAAGACTAATTCACTGGAACTTGAAGAGAAGAAAATTGTGCCACTCGAGCCTGCTA
TATATACATCCATTTATATTCGTTGGAGATCTTTCGACTAGCTTATCAAGGTCCTTCACA
GCTCAATGCTGACTTCGATGACTCCTCTGAGAGTCATGACTCCGAAAAGGAGGAGTCTAT
ACCTCAAGAAGAGTCAGAGATGTCGGGTAACGATTCAACCGGGTAACATGATTGTTATTT
CATAAGATTAGAATTCTGAAGCAATTTGGGATTGTGCCAAACCAATGCGAGCATCAAACT
GTTAGAGGAAATCCACAAATAAGGCCAAACAGAAGTAAACTCAGGGAGTTGAATTCGGGT
TAGAGATTTCAAAAGTCAAATCAAGATCAGTTAAACTGTA
Chr coordinates Chr XIII from 637004-636291
w3c xhtml validator w3c css validator