Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FMP42
Systematic Name YMR221C
Strain S288c
Description Putative protein of unknown function; the authentic, non-tagged protein is detected in highly purified mitochondria in high-throughput studies; physical interaction with Atg27p suggests a possible role in autophagy
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FMP42 YMR221C
ACTATAATCGAGGATTTTTTTTCACTTGAAAAATTCAAAGAAAAGCAAAAAAAGGAAGAA
TAGAGAAGAAAAAAAAGGTATAAGTGAAGAAAGAATGTGCAATACTACAAGACTATAAGA
TTTAATAGCTGTAACCATGACGAAGAATGTATTGATGTTACATGGGCTTGCGCAGTCAGG
TGACTACTTTGCCTCTAAGACAAAGGGGTTTCGCGCCGAAATGGAAAAGTTAGGATATAA
ACTCTACTATCCAACAGCACCCAATGAATTTCCCCCAGCTGATGTTCCTGATTTCTTGGG
TGAGGTAATTGCTGATGCACCTGGGGATGGTGAGAATACCGGTGTGCTTGCGTGGCTAGA
GAATGACCCTTCCACCGGTGGCTATTTCATACCGCAGACGACAATCGACTATTTACACAA
TTATGTCCTTGAAAATGGTCCATTTGCAGGTATTGTAGGATTTAGTCAAGGAGCCGGTGT
AGCTGGATACCTAGCAACGGATTTCAATGGTTTGTTGGGCCTTACAACAGAAGAACAGCC
GCCGCTAGAATTTTTCATGGCGGTCAGTGGTTTCAGGTTCCAACCACAACAGTATCAAGA
ACAGTACGACCTGCATCCAATATCGGTCCCATCTCTACATGTTCAAGGAGAACTTGACAC
TATCACAGAGCCGGCCAAAGTGCAAGGCCTATATAACTCTTGTACGGAAGACTCTCGCAC
TTTACTAATGCACTCTGGGGGCCACTTTGTGCCGAACTCAAGAGGGTTTGTGAGAAAAGT
GGCTCAATGGCTCCAGCAGTTGACCTGAGGCAAGTATATATAGCACGTAATCTTCACATA
ATCTTCACATACATATTTATACATGATTAAATCCTCCGGGTAATAATACGTCAAATTAAC
TTAACTACCGATACGATGCTTCATTATGATAACGATAACAATGGCATCTATAAATGATTT
TATTCCTCGTTAGGCCAGTATTAGGGCAGTAAAGACTGTA
Chr coordinates Chr XIII from 715445-713931
w3c xhtml validator w3c css validator