Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RNH1
Systematic Name YMR234W
Strain S288c
Description Ribonuclease H1; able to bind double-stranded RNAs and RNA-DNA hybrids; associates with RNAse polymerase I; the homolog of mammalian RNAse HII (the S. cerevisiae homolog of mammalian RNAse HI is RNH201)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RNH1 YMR234W
GTGAGGAAAGCCCTGCAAATTCTCTATTCAGTTAATTTGGATTCACAAAGAAAGTTAATT
AATGAATTGATTCTTGAGAGGTTCGGCGATATACAAGAAAACCCAAGAGTCTTAATTCCG
AAGAACGACCTCATTAGTCGGGATCAAGAACTATCTTTGAGGTTACAGAAGGAAGAAGAA
AGACCCTTGAGGTCTACGAGGAAAAGGAAAGGTAAAAGTGAAAGTAAATCTAAAAGGAAG
AAGAAAAAGAATGATAGTCCTGATTCCAACAGCATTTCCGTCCGCAAAGTTCTGTTGTCA
GCTCCTTTACAAAAGTTTCTAGGATCTGAAGAACTGCCACGAACGCAAGTAGTGAAGATG
ATATGGCAGTATATCAAAGAGCATGATCTTCAAAACCCAAAAGATCGTAGAGAAATTCTA
TGCGATGAGAAGATGGAACCAATTTTTGGCAAAAAAATGACGATGTTTTCAATGAATAAA
CTCTTAACTAAGCACTTGTTTAATCCCGATGAAATTGTGAAACATGAAGAGGAACAAAAG
CAAACACCCGAAAAAGAAATCAAATTGGAAAACGAATCTCTTCCCAATTTAAGCGGTTGA
TCTTGGCTGTAGCACTTATACAAATTTAATGATTTTTTTTCCTCTTTGATGACATGTATA
AAGCACACTGCACCTACTGTATTGTACTTGAAACAGGTAAATTAACAATTAATGTAGCAT
TAGTAATAAATAATTTCACTTCACGGCGTTAAAGAAATACTATGGCAAATTCGATTTGAG
AATTTCGTCAAATTCTGATGATATCAATTAATGGCATATTTTTTTTATTTTTTATCTGGA
GAAAAAAATGTAAAAATGACAGCAGCATCAACAATGAATAAAAGCAAGTACAATAGTCGT
AAAGATCTATATTAATTTCATGGCAGCACAATAATACACGTTGTTTAAATTAGTTAAAGT
GTCACTCCTTGCTTATCGAAGGAACTATCGATTCCTAATT
Chr coordinates Chr XIII from 740266-741312
w3c xhtml validator w3c css validator