Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SNO4
Systematic Name YMR322C
Alias HSP34
Strain S288c
Description Possible chaperone and cysteine protease, similar to bacterial Hsp31 and yeast Hsp31p, Hsp32p, and Hsp33p; DJ-1/ThiJ/PfpI superfamily member; predicted involvement in pyridoxine metabolism; induced by mild heat stress and copper deprivation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SNO4 YMR322C
CGTTGAGATTCGATTTTTTCCTCACCTTGTTTTGGTATTTCTATTGCAAGACAAAGTGAA
AGAAGAAGAAGTGGTGGTAAAAAATAACTATATATAATGAAAATTGTTACCTGGTGGGAA
TGCAAACTGTAAGTAATAACCTGCCAGATCCATGTTTCTATTATATACCTAAGAACCAGC
CAAGTTAGGTAAACGAGGAGTCTTTCAATATCTCTTTTCTAGTGAGAATGTTATTTAGGT
AAATGAACAAGTTACCACTATACTACTCACCCCCTACACTTTGTTTGTGACCTCTCCCCT
TATCCAGTTCATCGAAACTTTTTTTTCAACTTGTGGATCTGTGACATTGTCTACAAGAGC
CGATTTTGATGTCTGAACAAAAAACAACCTTACCTTTCCAGATGCAACTTTCCAGGAGAG
CTGCGTGAGTTTCAAATATTTAACATGTCGGAGAAAGCTCCCAAGTACTTCCTTGTTCTT
GTCATTTTTTCCTTATCTCCATCCTTTAAGGAAGCTATTTCCATTATGCGATTCTATAAA
TCCGAGCATGCGAGTATTTCTTTTCTTGGCGCGGAGTCGCTGATGACGCAATAGGCACAT
TCATGAACATCCAGGACTGGTAATCTTCTCGTCTTAAAAAAAATCCAACCACCAGTAAAG
AAACTCTTGGGTAAAATGCAGTATCTGAAATATTGCATAGCTGCAAATGAAGATATTCAG
TATCAGCATAGGTATTTTCATGAAGGATAGGTAAAAAGAAAGAAAAGAAAAATATCTTTT
TGACTGTCATTCTTGCAATTATCACAATTAGGGGACTTTAAAACCGATACTTGATATATG
AGCACAGTCAAGGGGCCGGTTCTTGAGATTTTAATGGAAAACAAGAAAGTTGCACATACA
GGTCTGCTTTTCTTTGCTTGCTCCAGACAACGATACTTAGAACTAAAACATATTTCTAGA
ACACTTTTCTCCTTCATTCAAAAAGAAAACTGGCCTTGCA
Chr coordinates Chr XIII from 919079-918366
w3c xhtml validator w3c css validator