Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PUB1
Systematic Name YNL016W
Alias RNP1
Strain S288c
Description Poly (A)+ RNA-binding protein, abundant mRNP-component protein that binds mRNA and is required for stability of many mRNAs; component of glucose deprivation induced stress granules, involved in P-body-dependent granule assembly
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PUB1 YNL016W
AGTGGAAATAATTGTGATAAACATGCGGAAAGAGTGCCAGCCTTAAATAATTCCGCATTG
TTGCTATGTCGTTTTGTTTTTGTTTTTGTTTTCGTCTTATTGGTATTTGTTCATTTTACG
ACCACAAAGGATCCAGGGCTTCTACTTGCACAGGGAGGGTTGCTTGGTTAATACAATGCA
AAGGTCAGAGATATTAAGATTTGTGAAGGGTGCATTCAATGAGTTTTTCCTTTAATGTGC
CCTAGAAAGGAAGTAGTACGAACATTTCTCAGTCGGAGTTTGCCGGAAATTCGAATGACA
GTGTAAGTTGATTTTTGTGGCACAGAGATAATGAGCGGTGGTTCTGGCACACATTTGTGA
CGTTGGTTTGATAGTGTGGAGGGAGGGTGAAAAACAGATAACAATGGTCTCTTGGCCCAG
TTGGTTAAGGCACCGTGCTAATAACGCGGGGATCAGCGGTTCGATCCCGCTAGAGACCAT
TCTTTTTTTACATTTCTCGCAATGTGATTTATTTTGCTTACCCTTCCCACTGCCGTTACA
AGGGAGGTGAACGAAGAGGCTTGTTAGCATAAGGTTTACGCGTTGCGGTTGTAAGCACAA
TGTTCTTACTAAACCTCTGAAGATTAATTATCCTAACGTATACTAATTAATTCAAAGAGA
ATATTTACTCGTTCTCTTTTCATCATTTTGTAACATAATTCTTTACGTATTTTCACTTCG
TACTTTTTTCAACTTTTTTTGCCTTCGCTTCTTTTTTGTTGTAATTTTTCAATTTTTTTT
TTTCATCGTTGGCCGTCTTTCCTTGTCCTTCATTTTCCTCTCGTAATAATCATTCAACTA
CGGTAAAGCATGCCTTTCCTTTTTTCTACTCTGCAGTTATTTTCATAATATCTACTGTTT
CCATTTCGTGCTTTAAGTTAGAGTTTAATCTTCCCTTCTATCATCTTAATAGCAGGTTCA
TAATAAGAAGATTACCACATCTACTCTTTGTTCGATTCCA
Chr coordinates Chr XIV from 602907-604268
w3c xhtml validator w3c css validator