Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YNL034W
Systematic Name YNL034W
Strain S288c
Description Putative protein of unknown function; not an essential gene; YNL034W has a paralog, YNL018C, that arose from a segmental duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YNL034W YNL034W
CCAGCAGAGAAGTCGCTACCGATGACCTTCATATCATTGATTGCAGTTTCGCTCGCCTTA
ATCTTTTGTACTGATTTACCAGTACTCCAGTCTAGCAAACGTATTTCGCCATTACTTAAT
CCAGTTAAAAGACCATGTTTATAACTAGGCTGTAACTTAAGACACCAATTTTCTGACCCG
AAAGAATTCGATTCAACTAAAGAATAACTAGCCATGCTCTAGAAGTTAATTTGAGATTCT
CGAACTTAAGTAGTTTTTATTTACACAGTAAGACGAGCCAGTGCCTATGTCCTAATGACT
GCGTACGTGCACTGTAGTCCCATCTAACATTTTTACAATCTGGACTAAGAAAACTTTTAT
AAATCACATTGCCAATGCAAAAAAAAAGAATGGTCTCTAGCGGGATCGAACCGCTGATCC
CCGCGTTATTAGCACGGTGCCTTAACCAACTGGGCCAAGAGACCACTGTTATCTGTTTTC
CACCGTCCCTCCACACTACCAAACCAACGTCACTACTGTGTGCCAGCACCACCGCTCATT
ATCCCTGTGCCACAAAACTCAACTTACACTGTCATTCGAATTTCCGGCAAACTCCGACTG
AGAAATGTTCGTACTACTTCCTTTCTAGGGCACATTGAGGAAAAACTCATTGAATGCACC
CTTTACAAATCTTAATATCTCTGACGTTTGTATTGTATTAACCAAGCAACCCTCCCTGTG
CAAGTAGAAGCCCTGGATCCTTTGTGGTCGTAAAATGAACAAATACCAATAAGACGAAAA
CAAAAACAAAAACAAAACGACATAGCAACAATGCGGAATTATTTAAGGCTGGCACTCTTT
CCGCATGTTTATCACAATTATTTCCACTTTCACTTAAAACCTTGTTTAAGCTTGGCCTAC
ACCACAGGAAAAAAAACCATCCGATCTAATCTTCAAATATCAATTTGAGGTTGAAAAAAT
TTGCTAAAGCGTTGGTCTAATTTTGTTTTTCGCCCACATA
Chr coordinates Chr XIV from 570477-572315
w3c xhtml validator w3c css validator